Oligodeoxynucleotides containing CpG motifs modulate the allergic T H2 response of BALB/c mice to Bet v 1, the major birch pollen allergen☆,☆☆,★

https://doi.org/10.1016/S0091-6749(99)70083-7Get rights and content

Abstract

Background: The use of adequate adjuvants to modulate the allergic T H2-type immune response is a promising concept for future immunotherapy of type I allergy. Bacterial DNA or oligodeoxynucleotides containing CpG motifs (CpG-ODNs) have been demonstrated to foster T H1-type immune responses. Objective: We investigated the adjuvanticity of CpG-ODNs and their capability to modulate the allergic T H2 response in a mouse model. Methods: BALB/c mice were treated with CpG-ODNs and Bet v 1, the major birch pollen allergen, in different experimental setups. Allergen-specific antibody responses, T H cytokines, and eosinophilic infiltration of the airways were investigated. Results: Intraperitoneal administration of Bet v 1 together with aluminium hydroxide led to a typical T H2 response. In contrast, coadminstration of CpG-ODNs with Bet v 1 in aluminium hydroxide resulted in markedly increased T H1 activities (high IgG2a levels) and subsequently to reduced airway inflammation. The T H1-like immune response indicated by these humoral findings was also reflected by decreased IL-5 and increased IFN-γ levels in cell cultures. CpG-ODNs as sole adjuvants with Bet v 1 did not lead to measureable Ig responses after subcutaneous or intraperitoneal immunizations; after intranasal application, 3 of 10 mice reacted. Nevertheless, a prophylactic effect was obtained with all routes tested; that is, mice treated subsequently with an established aerosol sensitization protocol displayed altered immune responses characterized by drastically elevated levels of Bet v 1–specific IgG2a, indicating a T H1/T H0-like immunity. Application of CpG-ODNs after aerosol sensitization also induced IgG2a. Conclusion: By inducing T H1/T H0-biased immune responses to allergens, the use of CpG-ODNs as adjuvants may have important impacts for new forms of specific immunotherapy in type I hypersensitivity. (J Allergy Clin Immunol 1999;1015-23.)

Section snippets

ODNs and allergens

ODNs with phosphorothioate modification of the backbone were synthesized and HPLC purified by MWG Biotech (Munich, Germany). The 20-mer used contained 3 CpG motifs (ie, ATCGACTCTCGAGCGTTCTC).9 In some experiments a control ODN lacking CpG motifs was used (ie, ATGCACTCTGCAGGC-TTCTC). The endotoxin content of the ODN was undetectable (<0.1 EU/6 μg of DNA) by means of Limulus assay (BioWhittaker Bioproducts, Walkersville, Md). Birch pollen (Allergon AB, Engelholm, Sweden) was extracted in PBS, as

Modulation of the Al(OH)3-induced response to Bet v 1 (group 1)

To induce T H2 responses to Bet v 1, mice were immunized 3 times intraperitoneally with Bet v 1 in Al(OH) 3 at 14-day intervals and killed 7 days after the last treatment. Bet v 1–specific antibodies were investigated in the respective sera by means of ELISA. The humoral immune response was dominated by IgG1 and IgE production (Fig 2, A-C, 1 ).

. Coadministration of CpG-ODNs modulates the Al(OH) 3-induced immune response to Bet v 1. Ig isotype distribution of Bet v 1–specific antibodies in sera

DISCUSSION

SIT is the treatment of choice in type 1 allergy and has been successfully used in venom hypersensitivity and in patients with pollinosis.27 A possible approach to further improve the effectiveness of SIT is to develop adjuvants that may be better suited than Al(OH) 3, which is conventionally injected subcutaneously together with allergen during SIT and has been shown to induce T H2 responses.7, 28 In addition, other routes of application, especially mucosal application (oral, sublingual, and

Acknowledgements

We thank Mrs R. Steiner-Göltl for excellent technical support.

References (48)

  • B Jahn-Schmid et al.

    Bet v 1, the major birch pollen allergen, conjugated to crystalline bacterial cell surface proteins, expands allergen-specific T-cells of the Th0/Th1 phenotype in vitro by induction of IL-12

    Int Immunol

    (1997)
  • U Wiedermann et al.

    Effects of adjuvants on the immune reponse to allergens in a murine model of allergen inhalation: cholera toxin induces a Th1-like response to Bet v 1, the major birch pollen allergen

    Clin Exp Immunol

    (1998)
  • AM Krieg et al.

    CpG motifs in bacterial DNA trigger direct B-cell activation

    Nature

    (1995)
  • D Klinman et al.

    CpG motifs expressed by bacterial DNA rapidly induce lymphocytes to secrete IL-6, IL-12 and IFN

    Proc Natl Acad Sci USA

    (1996)
  • GB Lipford et al.

    CpG-containing synthetic oligonucleotides promote B and cytotoxic T cell responses to protein antigen: a new class of vaccine adjuvants

    Eur J Immunol

    (1997)
  • M Roman et al.

    Immunostimulatory DNA sequences function as T helper 1-promoting adjuvants

    Nat Med

    (1997)
  • RS Chu et al.

    CpG oligo-nucleotides act as adjuvants that switch on T helper 1 (Th1) immunity

    J Exp Med

    (1997)
  • AP. Bird

    CpG-rich islands and the function of DNA methylation

    Nature

    (1986)
  • A Yi et al.

    IFN-γ promotes IL-6 and IgM secretion in response to CpG motifs in bacterial DNA and oligonucleotides

    J Immunol

    (1996)
  • ZK Ballas et al.

    Induction of NK activity in murine and human cells by CpG motifs in oligodeoxy-nucleotides and in bacterial DNA

    J Immunol

    (1996)
  • P. Matzinger

    Tolerance, danger and the extended family

    Ann Rev Immunol

    (1994)
  • B Bohle et al.

    Oligodeoxynucleotides containing CpG motifs induce IL-12, IL-18 and IFN-γ production in cells from allergic individuals and inhibit IgE synthesis

    Eur J Immunol

    (1999)
  • A-K Yi et al.

    Cutting edge: rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA

    J Immunol

    (1998)
  • S Sun et al.

    DNA as an adjuvant: capacity of insect DNA and synthetic oligonucleotides to augment T cell responses to specific antigen

    J Exp Med

    (1998)

    • Cited by (0)

    ☆

    Supported by grants from the Austrian Science Foundation (P12889-MED and S7206-MOB), the Austrian Federal Ministry of Science and Transportation, and ALK-Abello, Hørsholm, Denmark.

    ☆☆

    Reprint requests: Christof Ebner, MD, Institut für Allgemeine und Experimentelle Pathologie, Universität Wien, AKH-EBO 3Q, Währinger Gürtel 18-20, A-1090 Wien, Austria.

    ★

    0091-6749/99 $8.00 + 0  1/1/101793

    View full text
    Copyright © 1999 Mosby, Inc. All rights reserved.