Table 2—

Primers and probes

GenePrimers/probesPrimer sequence (5′–3′)Annealing temperature °C
MMP12ForwardTGCTAATTGATCCATTGTCG/57
 A-82GReverseGAGCTCCAGAAGCAGTGG/57
AnchorAGCCCTTAGTCCGGGTTCTGTGAA-FL
Sensor mut610-TGAATCCTATGAGTGACTCACAGTTGAT-PH
MMP12ForwardTGGGAACCATAGAAAAGAGACTA/57
 A1082GReverseGGTCCTATAAAAACGTGGGT/57
Anchor670-GCCAAATTATCCCAAGAGCATACATTCTT-PH
Sensor wtACTGGTTAATTAGCAATTTAAGACCAG-FL
MMP3ForwardGAGCTGCCACAGCTTCTACA/55
 6A-11715AReverseCTCAACCTCTCAAAGTGCTAGGAT/55
Anchor640-CCATCAAAGGAATGGAGAACCATAGAATAC
Sensor wtAAGACATGGTTTTTTCCCCX
  • Bold letters show where the polymorphism was situated and 610, 670 and 640 indicate the fluorescent dye. mut: mutation; wt: wild-type; FL: fluorescein; PH: phosphate.