Table 1—

Primer sequences for iPLEX™ genotyping assay for the nicotinic acetylcholine receptor α5 and α3 subunit single nucleotide polymorphism (SNP)

SNP IDFirst PCR primerSecond PCR primerExtension primer
rs16969968ACGTTGGATGCACGGACGTTGGATGTCTAGAAACATTGGAAGCTGCGCTC
ACATCATTTTCCTTCCACATTGGAAGC
rs1051730ACGTTGGATGCAGCAACGTTGGATGTCAAGGACTCATCAAAGCCCCAGGCTA
GTTGTACTTGATGTCTATTGGGAGAGC
  • iPLEX™ is manufactured by Sequenom, San Diego, CA, USA.