Table 2—

TaqMan® primer and probe sequences

SNPPrimersProbes
DirectionSequenceAlleleSequence#
CSF2 -1440FAACTCCCACAGTACAGGGAAACTGG6FAM-ACTCAGGCCACAGTG-MGBNFQ
RCAGAGAGCAGGTGGAGTTCATGAVIC-CTCAGACCACAGTGC-MGBNFQ
CSF3 -1719FGCAATGAGCGAAACTCCATCTCCVIC-CCCACCCTCTACTC-MGBNFQ
RTGATGTGGCCCAGCTCTGTACT6FAM-CCCACTCTCTACTCC-MGBNFQ
CSF3 -882FCAGCCCGTGTCCACTTCAAG6FAM-ACGTGACTTCCCTGGT-MGBNFQ
RTTGGAACTGCGGGATTGGAVIC-ACACGTGATTTCC-MGBNFQ
CSF3 2176FCAGGTGCCTGGACATTTGCC6FAM-CAGTCCCCGTCCAGC-MGBNFQ
RGTCTGCTCCCTCCCACATCTVIC-CAGTCCCCATCCAGC-MGBNFQ
  • SNP: single nucleotide polymorphism; CSF: colony-stimulating factor; F: forward; R: reverse; 6FAM and VIC: reporter fluorophores; MGBNFQ: minor groove-binding nonfluorescent quencher. #: underlining indicates SNP position; : probes are designed to the reverse strand.