Probes used for quantitative real-time PCR of the studied genes
| Genes | Assay identification | Nucleotide sequence (5′–3′) | GenBank accession number |
| TNF-α | Hs00174128_m1 | ATGTTGTAGCAAACCCTCAAGCTGA | NM_000594 |
| IL-1β | Hs00174097_m1 | TATGGAGCAACAAGTGGTGTTCTCC | NM_000576 |
| IL-6 | Hs00174131_m1 | ATTCAATGAGGAGACTTGCCTGGTG | NM_000600 |
| IL-10 | Hs00174086_m1 | CTACGGCGCTGTCATCGATTTCTTC | NM_000572 |
| β-Actin# | Hs99999903_m1 | TCGCCTTTGCCGATCCGCCGCCCGT | NM_001101 |
All TaqMan® minor groove binder probes were dual-labelled with a reporter dye (6-carboxy-fluorescein) at the 5′ end and a nonfluorescent quencher at the 3′ end. TNF: tumour necrosis factor; IL: interleukin. #: housekeeping.