Table 1—

Sequence of primers and probes for cytokines andβ-actin used in real-time PCR

Target sequencePrimerSequence 5'–3'Gene bank accession numberPosition
β-ActinSenseCCACCATGTACCCTGGCANM-001101981–998
ProbeAAGATCAAGATCATTGCTCCTCCTGAG1049–1075
AntisenseCACATCTGCTGGAAGGTGGA1121–1140
IFN-γSenseATATTTTAATGCAGGTCATTCAGATGTAX01992234–262
ProbeTTGAAGAATTGGAAAGAGGAGAGTGACAGAAAAATA291–327
AntisenseTGAAGTAAAAGGAGACAATTTGGCT334–358
TNF-αSenseTCTTCTCGAACCCC GAGTGAAF04334210–29
ProbeTAGCCCATGTTGTAGCAAACCCTCAAGCT38–66
AntisenseCCTCTGATGGCACCACCAG142–160
IL-10SenseGCTGGAGGACTTTAAGGGTTACNM-000572269–290
ProbeAGAACCAAGACCCAGACATCAAGGC355–379
AntisenseACAGGGAAGAAATCGATGACAG434–455
IL-12p40SenseTGGAGTGCCAGGAGGACAGTAF180563578–597
ProbeATGGTGGATGCCGTTCACAAGCTCAA637–662
AntisenseTCTTGGGTGGGTCAGGTTTG705–724
IL-4SenseGCCTCACAGAGCAGAAGACTCTM13982182–203
ProbeTGCTGCCTCCAAGAACACAACTGA234–260
AntisenseTCTCATGGTGGCTGTAGAACTG295–316
TGF-β1SenseCAGCAACAATTCCTGGCGATACNM-000660890–912
ProbeCTGCTGGCACCCAGCGACTCG925–945
AntisenseAAGGCGAAAGCCCTCAATTT1007–1026
  • IFN: interferon; TNF: tumour necrosis factor; IL: interleukin; TGF: transforming growth factor.