Table 2

Polymerase chain reaction primers: phase determination using allele-specific primers

Nucleotide variantsPrimer locationPrimers (5′ to 3′)
745T/C (intron 1)Intron 1Allele-specific primers#745T (F): ATGACCTCATGCCTGTCTCCT
745C (F): ATGACCTCATGCCTGTCTCCC
T1286C (exon 3)Intron 3Common primerIntron 3 (R): GTGGCTCTAGCAGAGCCTTGT
  • #: allele-specific nucleotides are underlined