Table 1—

Primers used for detection of polymorphism at position 2258 of the Toll-like receptor 2 (TLR2) gene

PrimerNucleotide sequence
TLR2‐FTATGGTCCAGGAGCTGGAGA
TLR2‐RTGACATAAAGATCCCAACTAGACAA
TLR2‐GGGTCTTGGTGTTCATTATCTTCC
TLR2‐AGGTCTTGGTGTTCATTATCTTCT
  • T: thymine

  • A: adenine

  • G: guanine; C: cytosine