Table 2– Detected variants in the OS9 exonic, exon-flanking and regulatory regions
SNPPosition bp, hg19LocationAllele A1>A2Context sequenceA1A1/A1A2/A2A2 casesA1A1/A1A2/A2A2 controls
rs476031958,087,486UpstreamT>C41/4/040/4/1
rs476016858,087,737UpstreamG>T26/13/630/13/2
OS9-SNP158,088,665Non-synon (Pro>Thr)C>AAAGGGAGGAGGAAACACCTGCTTACCAAGGGCCTGGGATC[C/A]CTGAGTTGTTGAGCCCAATGAGAGATGCTCCCTGCTTGCTGA45/0/041/1/0
rs11453282858,090,051IntronT>C45/0/044/1/0
rs7312547758,109,707Coding-synonT>G45/0/044/1/0
rs79926558,112,189Coding-synonG>A22/11/824/12/9
OS9-SNP258,114,081IntronC>TCTGCAGGTGGGCCCTGGAGGGCGGCTGGACCCAGTGCTGT[C/T]GGAAGGGCAAGCTGCCGGAAGTGGAGGGGCTGGGACCAGT45/0/044/1/0
rs105004558,115,2713′-UTRT>C11/12/2410/9/24
rs7436819158,115,2863′-UTRG>A43/2/045/0/0
  • Samples were enriched for homozygote and heterozygote carriers of the rs1050045 risk allele C and sequenced using Sanger sequencing technology. The location is given relative to the OS9 gene region and the numbers of homozygotes for the minor allele, heterozygotes and homozygotes for the major allele are denoted by “A1A1/A1A2/A2A2”. SNP: single nucleotide polymorphism; Non-synon: non-synonymous; Coding-synon: coding synonymous; UTR: untranslated region.