Imbalanced secretion of IL‐1β and IL‐1RA in Chlamydia pneumoniae-infected mononuclear cells from COPD patients

Subjects

For in vitro experiments, PBMCs and AMs were isolated from COPD patients who underwent fibreoptic bronchoscopy for diagnostic evaluation of peripheral solitary pulmonary nodules. All COPD patients and controls (healthy male volunteers) were without clinical and laboratory signs of acute infection at the time of bronchoscopic examination. Diagnosis of COPD was made according to American Thoracic Society guidelines 11. Spirometry (BodyScope; Ganshorn Medizin, Niederlauer, Germany) was performed in the sitting position, and forced expiratory volume in one second (FEV₁) and forced vital capacity measured. At the same time point, venous blood from patients and volunteers was drawn from a cubital vein into four 10‐mL tubes containing ethylene diamine tetra-acetic acid (Sarstedt, Nümbrecht, Germany).

The protocol was approved by the Ethical Committee of the Medical University of Lübeck (01-084). All volunteers gave written informed consent.

BAL

Bronchoalveolar lavage (BAL) was performed as described previously 12. In brief, a fibreoptic bronchoscope was wedged into the right middle lobe. A total of 200 mL phosphate-buffered isotonic saline (pH 7.4, 25°C) was instilled sequentially and gently aspirated. The amount of returned fluid was>60% of the total infused volume in all patients and volunteers. Aliquots were retained for further microbiological testing. The chilled BAL fluid (BALF) was strained through a single layer of coarse gauze and centrifuged for 15 min at 400×g at 4°C to recover cells. After washing steps with saline, the cell pellet was resuspended in serum-free Roswell Park Memorial Institute (RPMI) 1640 medium (Sigma, Taufkirchen, Germany) and adjusted to an AM density of 1×10⁶ cells·mL⁻¹.

C. pneumoniae nested PCR using BAL fluid

BALF was analysed for genomic C. pneumoniae deoxyribonucleic acid (DNA) using a nested polymerase chain reaction (PCR) protocol 13. Briefly, DNA was purified from BALF via proteinase K digestion and cetyltrimethylammonium bromide treatment. Nested PCR was then performed using the species-specific HL‐1/HR‐1 primer pair and the nested primer pair IN‐1/2 that yields a product of 128 base pairs. Nonradioactive DNA hybridisation was performed using oligonucleotide HM‐1 3′‐labelled with digoxigenin-deoxyuridine triphosphate (Boehringer Mannheim, Mannheim, Germany) as the probe.

Isolation of human PBMCs

Isolation of PBMCs was performed by density centrifugation of blood diluted 1:2 in pyrogen-free saline over Histopaque (Sigma). PBMCs were washed twice in saline, resuspended in RPMI 1640 medium and adjusted to 1×10⁶ cells·mL⁻¹ as described for AMs.

Culture of C. pneumoniae

The pulmonary C. pneumoniae strain CWL‐029 (American Type Culture Collection (ATCC) VR‐1310) was grown on HEp‐2 monolayers as described previously 14. Briefly, immortalised laryngeal epithelial cells (HEp‐2, ATCC CLL 23) were grown in tissue culture plates in Eagle minimal essential medium (Sigma) containing 10% foetal calf serum (Biochrom KG, Berlin, Germany), l‐glutamine (Invitrogen, Leek, the Netherlands; 2 mM), nonessential amino acids (Invitrogen), gentamicin (Sigma; 10 mg·L⁻¹), vancomycin (Sigma; 50 mg·L⁻¹) and amphotericin B (Sigma; 2 mg·L⁻¹). Confluent monolayers were infected with C. pneumoniae and growth medium was replaced by an antibiotic-free medium.

Infection of AMs and PBMCs with C. pneumoniae

AMs and PBMCs were seeded into six-well plates (Invitrogen) for determination of messenger ribonucleic acid (mRNA) expression (at 4, 12, 24 and 48 h); cover slips were inserted into the plates to allow mononuclear cell adherence and facilitate staining procedures. After 2 h, the nonadherent population was removed and fresh medium containing C.pneumoniae (50% tissue culture infective dose=1×10^−2.7 dilution/1×10⁶ inclusion forming units·mL⁻¹) added. Supernatants were used for cytokine measurements and stored at −70°C.

Real-time PCR

Total ribonucleic acid (RNA) from AMs and PBMCs from COPD patients was isolated using a NucleoSpin RNA II kit(Macherey-Nagel, Düren, Germany). Extracted RNA wasreverse transcribed to give complementary DNA using random primers and reverse transcriptase according to the manufacturer's protocol (First-Strand PCR kit; Roche, Mannheim, Germany). PCR amplification and quantification was performed using the LightCycler Detection System (Roche Molecular Biochemicals, Mannheim, Germany). Primers were designed using computer software containing minimal internal structure and having compatible melting temperatures. The sequences of the primers are as follows: forward glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH): 5′‐TCTGCCCCCTCTGCTGATGCCCCC‐3′; reverse GAPDH: 5′‐CCATCACGCCACAGTTTCCCGGAG‐3′; forward IL‐1β: 5′‐CTGATGGCCCTAAACAGATGAAG‐3′; reverse IL‐1β: 5′‐GGTCGGAGATTCGTAGCAGCTGGAT‐3′; forward IL‐1RA: 5′‐GGAATCCATGGAGGGAAGAT‐3′; and reverse IL‐1RA: 5′‐CCTTCGTCAGGCATATTGGT‐3′. The PCR product was monitored in real-time by measuring the increase in fluorescence caused by the binding of SYBR Green I Dye (Roche Molecular Biochemicals) to double-stranded DNA.

Determination of cytokine concentrations

Concentrations of IL‐1β, IL‐1RA and IL‐8 were determined in cell supernatants by means of enzyme-linked immunosorbent assays with detection limits of 3.9, 31.2 and 16 pg·mL⁻¹, respectively (Biosource International, Camarillo, CA, USA; Bender MedSystems, Vienna, Austria; and R&D Systems, Minneapolis, MN, USA).

Fluorescence microscopy

A two-colour fluorescence assay (LIVE/DEAD® kit; MolecularProbes, Eugene, OR, USA) was used to determine the viability of C. pneumoniae and PBMCs over 48 h. Green fluorescence indicated viable cells as the highly membrane permeable dye (Syto 9) labels cells with intact plasma membranes. In contrast, the red fluorescent nucleic acid stain (propidium iodide) labels only cells with disrupted membranes. C. pneumoniae-infected PBMCs and AMs were seeded on to sterile glass coverslips and incubated with both fluorescent dyes (at 1:300 dilution) for 45 min in darkness. Dye solution was removed, cells were fixed in 1% paraformaldehyde for 10 min and stored at −4°C. Infection rates weredetermined using a fluorescein isothiocyanate-conjugated antichlamydial antibody (Dako, Hamburg, Germany).

Statistical analysis

For statistical analysis, nonparametric tests were used throughout the study. As maximum IL‐1β secretion from C.pneumoniae-infected PBMCs was detected after 24 h, this time was appointed for the statistical analysis of samples fromthe COPD patients and healthy controls (Mann-Whitney U‐test). A p<0.05 was considered significant.

Study subjects

The clinical characteristics of the subjects are shown in table 1⇓. All COPD patients and volunteers were male current smokers with a cumulative cigarette consumption of ≥6 pack-yrs. None of the COPD patients were receiving systemic steroids or antibiotic treatment at the time of the study. No potentially pathogenic microorganisms were isolated from BALF, and PCR was negative for C. pneumoniae in all COPD patients and healthy controls included in the study.

Infection rates and viability of C. pneumoniae-infected AMs and PBMCs

Inclusion-forming bodies of C. pneumoniae were observed 24 and 48 h after infection of AMs and PBMCs (fig. 1a and b⇓), indicating an intracellular infection. In mononuclear cells from COPD patients and healthy volunteers, infection rates ranged from 65±10% in AMs to 73±8% in PBMCs without differences between the two groups. Viable C.pneumoniae could be detected in viable AMs (fig. 1c and d⇓) and PBMCs over 48 h with live/dead staining.

• Download figure
• Open in new tab
• Download powerpoint

Fig. 1.—

Fluorescence microscopy with fluorescein isothiocyanate-conjugated antichlamydial antibody showing the development of intracellular chlamydial infection in peripheral blood mononuclear cells after a) 24 h and b) 48 h. Increasing viability of Chlamydia pneumoniae was demonstrated in alveolar macrophages after c) 24 h and d) 48 h by live/dead staining. Arrows/arrowheads indicate C. pneumoniae.

Expression of IL‐1β and IL‐1 receptor antagonist in C. pneumoniae-infected AMs and PBMCs from COPD patients

In order to evaluate the time course of pro- and anti-inflammatory cytokine production in AMs and PBMCs from COPD patients, IL‐1β and IL‐1RA expression and mRNA levels were determined 4, 12, 24 and 48 h after chlamydial infection in a subgroup of six patients. Levels of IL‐1β mRNA were significantly enhanced four-fold 4 h after infection of AMs and PBMCs with C. pneumoniae. Secretion of IL‐1β from AMs reached maximum levels 24 h after chlamydial infection with continual decrease up to 48 h (fig. 2a⇓). In contrast, infection with C. pneumoniae did not result in enhanced levels of IL‐1RA mRNA. There was no significant difference in release of IL‐1RA from C. pneumoniae-infected and noninfected AMs (fig. 2b⇓) and PBMCs at 24 h.

• Download figure
• Open in new tab
• Download powerpoint

Fig. 2.—

Time course of a) interleukin (IL)‐1β and b) IL‐1 receptor antagonist (IL‐1RA) secretion from Chlamydia pneumoniae-infected (└) and noninfected (□) alveolar macrophages (AMs) from chronic obstructive pulmonary disease patients (n=6). Within 12 h, secretion of IL‐1β was significantly enhanced in infected AMs, whereas release of IL‐1RA from AMs remained unaffected by infection over 48 h. **: p<0.01 versus noninfected AMs.

IL‐1β/IL‐1 receptor antagonist ratio in C. pneumoniae-infected AMs and PBMCs from COPD patients and healthy volunteers

Infection of AMs and PBMCs from COPD patients with C.pneumoniae resulted in increased secretion of IL‐1β. Compared to healthy controls, the maximum increase was 2.5‐fold in AMs and 2.3‐fold in PBMCs, starting from similar baseline levels. Strikingly, enhanced release of its anti-inflammatory counterpart IL‐1RA was absent in preactivated AMs and PBMCs from COPD patients after chlamydial infection (fig. 3⇓). In contrast, mononuclear cells from healthy volunteers possessed the capacity to functionally balance the pro-inflammatory immune response by secreting increased amounts of IL‐1RA (106.8±40.6 versus 69.0±38.7 ng·mL⁻¹ from AMs and 16.9±6.0 versus 5.8±4.2 ng·mL⁻¹ from PBMCs; p<0.05) after chlamydial infection.

• Download figure
• Open in new tab
• Download powerpoint

Fig. 3.—

Secretion of a, c) interleukin (IL)‐1β and b, d) IL‐1 receptor antagonist (IL‐1RA) from a, b) alveolar macrophages (AMs) and c, d) peripheral blood mononuclear cells (PBMCs) from chronic obstructive pulmonary disease (COPD) patients (♦) and healthy controls (•) 24 h after infection with Chlamydia pneumoniae. Horizontal bars represent means (n=8). Infection of AMs and PBMCs from COPD patients resulted in an increased IL‐1β/IL‐1RA ratio compared to healthy volunteers due to enhanced expression of IL‐1β but unchanged secretion of IL‐1RA. *: p<0.05; ^#: p=0.016; ^¶: p=0.009.

Taken together, the IL‐1β/IL‐1RA ratio (×1,000) in AMs (and PBMCs) from COPD patients increased significantly from 6.3±2.9 to 27.1±4.1 (170.6±65.2 to 511.4±196.5 in PBMCs) in response to C. pneumoniae infection. In the control group, infection of AMs with C. pneumoniae did not significantly affect the IL‐1β/IL‐1RA ratio (4.6±2.5 versus 7.3±1.2), whereas there was a tendency for it to decrease in C.pneumoniae-infected PBMCs (186.6±92.7 versus 85.4±20.6).

Release of IL‐8 from C. pneumoniae-infected AMs from COPD patients and healthy volunteers

In both groups, infection of AMs with C. pneumoniae resulted in a 4.5‐fold increase in IL‐8 secretion. In contrast to other cytokines, basal IL‐8 levels in unstimulated AMs from COPD patients were significantly enhanced compared to the control group (283.0±112.0 versus 6.5±2.3 ng·mL⁻¹; p<0.05). As the inducibility of IL‐8 secretion from AMs was similar in both groups, infection of AMs from COPD patients with C.pneumoniae resulted in significantly enhanced IL‐8 levels (1324.4±498.3 versus 43.9±14.9 ng·mL⁻¹; p<0.05).