Dexamethasone accelerates catabolism of leukotriene C4 in bronchial epithelial cells

M. Zaitsu, Y. Hamasaki, K. Tsuji, M. Matsuo, I. Fujita, Y. Aoki, E. Ishii, O. Kohashi
European Respiratory Journal 2003 22: 35-42; DOI: 10.1183/09031936.03.00004402

Abstract

Leukotriene (LT)C4, a potent chemical mediator in bronchial asthma, is metabolised to the less active LTE4 via LTD4 in two consecutive reactions catalysed by enzymes of the glutamyl transpeptidase and dipeptidase families. The activities of these catabolic enzymes may be influenced by glucocorticosteroids. This study was conducted to examine whether this inactivation of LTC4 is affected by dexamethasone (DEX) in transformed human bronchial epithelial cells and normal human bronchial epithelial cells.

After incubation with DEX for 0–5 days, cells were resuspended in the presence of exogenous LTC4, and conversion of LTC4 to LTE4 was measured using high-performance liquid chromatography. γ‐Glutamyl transpeptidase (GGT) and GGT-related enzyme (GGTRE) messenger ribonucleic acid (mRNA) expression were examined using reverse transcriptase-polymerase chain reaction analysis, and GGT activity by enzyme assay.

Conversion to LTE4 was accelerated by DEX pretreatment. GGTRE but not GGT mRNA expression was enhanced after incubation with DEX.

The results indicate that dexamethasone transcriptionally upregulates the activity of γ‐glutamyl transpeptidase-related enzyme in human bronchial epithelial cells, which accelerates inactivation of leukotriene C4 via conversion to leukotriene E4. This is a novel mechanism of glucocorticosteroids in human bronchial epithelial cells.

This study was supported, in part, by a grant from the Ministry of Education, Science, Sports and Culture, Tokyo, Japan.

Cysteinyl leukotrienes (cysLTs), leukotriene (LT)C4, LTD4 and LTE4, metabolites of the arachidonate 5‐lipoxygenase (5‐LO) pathway 1, 2, are produced in mast cells, basophils and eosinophils in the process of allergic inflammation. CysLTs stimulate mucus secretion, induce bronchial hyperresponsiveness, cause constriction of airway smooth muscle and increase vascular permeability 3–9. All of these symptoms are associated with asthma in humans. In clinical studies, cysLT-receptor antagonists were therapeutically effective in bronchial asthma 10, 11. It was also shown that a part of the early- and late-phase reactions caused by antigen challenge was prevented by cysLT-receptor antagonists in patients with asthma. Thus, cysLTs are considered to be strongly associated with the pathophysiology of human bronchial asthma 1, 12.

The synthesis of LT is initiated by transmembranous stimulation by various factors that increase the level of intracellular calcium ions, leading to translocation of cytosolic phospholipase (cPL)A2 from the cytosol to the nuclear membrane. cPLA2 cleaves arachidonic acid from the membrane phospholipid of the nucleus. The released arachidonic acid is converted into LTA4 via an unstable intermediate, 5‐hydroperoxyeicosatetraenoic acid, by 5‐LO, which is also translocated from the cytosol to the nuclear membrane, where 5‐LO-activating protein resides. The next step is the transformation of LTA4 to LTC4 by conjugation of LTA4 by LTC4 synthase on the surface of the cell nuclear membrane. The synthesised LTC4 on the cell nuclear membrane is released outside the cells. LTC4 is enzymatically metabolised to LTE4 via LTD4 by the consecutive action of two enzyme families: glutamyl transpeptidases, including γ‐glutamyl transpeptidase (GGT; or γ‐glutamyltransferase, EC 2.3.2.2), which remove the glutamyl moiety from the structure of LTC4, and dipeptidases 13, 14. These catabolic enzyme families exist in the bronchial epithelium and in serum. Bronchial epithelial cells do not produce LTC4 due to a lack of 5‐LO, however, they catabolise LTC4 to the less active LTE4. It had been thought that GGT was the only enzyme to mediate the conversion of LTC4 to LTD4. The other enzyme showing GGT- like activity, named GGT-related enzyme (GGTRE) or γ‐glutamyl leukotrienase (GGL) was recently identified in humans and mice 15, 16. Similar findings were demonstrated for dipeptidases 17.

CysLTs interact with cysLT receptors on the surface of effector cells. Among cysLTs, LTE4 is less active than LTC4 and LTD4 7–9, 14, 18, 19. Thus, the conversion of LTC4 to the final metabolite, LTE4, by these two catabolic enzymes is an important step in inactivation. These catabolic enzymes may be influenced by various antiasthmatic drugs. It was demonstrated recently that inhaled glucocorticosteroids, fluticasone propionate and beclomethasone dipropionate accelerated LTC4 catabolism to LTD4 20.

The aim of the present study was to examine whether dexamethasone (DEX) stimulates the inactivation process via conversion of LTC4 to LTE4 and to further investigate the mechanism of this reaction in human bronchial epithelial cells.

Materials and methods

Materials

Minimal essential medium (MEM), antibiotic/antimycotic solution (a mixture of penicillin G, streptomycin and amphotericin B) and Moloney murine leukaemia virus reverse transcriptase (RT) were from Gibco BRL (Grand Island, NY, USA); oligodeoxythymidine primer, RNA guard, ethidium bromide and the 100 base pair (bp) deoxyribonucleic acid (DNA) ladder were from Pharmacia (Uppsala, Sweden); l‐γ‐glutamyl‐p‐nitroanilide, glycylglycine, dexamethasone-21-acetate, A23187, diethyl pyrocarbonate (DEPC) and foetal bovine serum (FBS) were from Sigma Chemical Co. (St Louis, MO, USA); Primaria tissue culture dishes were from Becton Dickinson Labware (Franklin Lakes, NJ, USA); agarose MS−12 was from Cosmo Bio (Tokyo, Japan); ethylenediamine tetraacetic acid (EDTA) was from Wako (Osaka, Japan); LTC4, LTD4 and LTE4 were from Funakoshi (Tokyo, Japan); deoxyribonucleoside triphosphate (dNTP) mixture and recombinant Taq DNA polymerase were from Takara Shuzo (Kyoto, Japan); Isogen was from Nippon Gene Co. (Tokyo, Japan); and polymerase chain reaction (PCR) primer pairs specific for β‐actin, GGT and GGTRE were from Nippon Seifun (Tokyo, Japan). All other materials were of the highest quality available and purchased from commercial sources.

Cell culture

A simian virus 40 large T‐antigen-transformed human bronchial epithelial cell line (16HBE), which retains the differentiated morphology and function of normal human airway epithelium 21, 22, was cultured in MEM with 10% heat-inactivated FBS in Petri dishes as described previously 23. Primary isolated normal human bronchial epithelial (NHBE) cells were purchased from Clonetics Corp. (San Diego, CA, USA) and cultured in small airway cell basal medium, which was supplied by the vendor.

Measurement of conversion of LTC4 to LTE4via LTD4 (cell-free study)

Epithelial cell monolayers were grown to 80% confluence in Petri dishes (diameter 100 mm) and incubated for the indicated periods of time (0–5 days) in culture medium containing various concentrations of DEX (0–1×10−6 M) at 37°C under 5% carbon dioxide. The cells were recovered after incubation and washed three times with phosphate-buffered saline (PBS) containing 137 mM NaCl, 2.7 mM KCl, 8.1 mM NaH2PO4 and 1.5 mM K2PO4 (pH 7.4). The cells (2×106) were resuspended in 100 µL 100 mM tris-(hydroxymethyl)-aminomethane (Tris)/HCl (pH 8.0) and subjected to sonication (model R‐225R; Heat Systems-Ultrasonics Inc., Plainview, NY, USA) three times for 5 s on ice. The cell lysate was used as an enzyme source after the protein concentration was determined by the method of Lowry 24. Cell lysate (100 µL) was incubated with 100 ng exogenous LTC4 (in 100 µL PBS) for 60 min at 37°C. The reaction was stopped by the addition of 2 mL methanol. The amounts of LTC4, LTD4 and LTE4 in the incubation medium were measured by high-performance liquid chromatography (HPLC).

LTD4 catabolism was determined under the same conditions except that 100 ng LTD4, instead of LTC4, was added to the cell lysate and levels of LTD4 and LTE4 were measured.

High-performance liquid chromatographic measurement of LTC4, LTD4 and LTE4

The levels of LTC4, LTD4 and LTE4 for determining enzymatic conversion of LTC4 to LTE4 via LTD4 were measured by HPLC as described previously 20. Briefly, the sample was partially purified and concentrated by passage through a Sep Pak C18 cartridge (Waters, Milford, MA, USA) and applied to an HPLC system (TOSO-8010; Toso, Tokyo, Japan) equipped with a Nova Pak C18 column (Waters). The sample was eluted with acetonitrile/methanol/water/acetic acid (31.00/17.68/51.24/0.68 (v/v)) at 0.8 mL·min−1 and absorbance at 280 nm was monitored using a spectrophotometer. The retention times for LTC4, LTD4 and LTE4 were ∼6, ∼8 and ∼9 min, respectively.

Measurement of conversion of LTC4 to LTE4via LTD4 in intact cells

The cells were incubated in Petri dishes (diameter 35 mm) with or without 1×10−7 M DEX for 2 days, as above. After incubation, the medium was removed. The cells were washed three times with PBS and 100 ng LTC4 in 1 mL PBS was added. After incubation for 0–6 h, the reaction was stopped by the addition of 3 mL methanol and the culture medium collected. The amounts of LTC4, LTD4 and LTE4 in the medium were measured by HPLC.

Measurement of GGT activity

Cells were incubated in Petri dishes (diameter 100 mm) with DEX, as described above, and cell lysate prepared. The lysate was used as an enzyme source after the protein concentration was determined. GGT activity was determined using a rate-kinetic assay involving l‐γ‐glutamyl‐p‐nitroanilide and glycylglycine as described previously 25. Briefly, 900 µL reaction mixture (1 mM l‐γ‐glutamyl‐p‐nitroanilide, 20 mM glycylglycine, 100 mM Tris/HCl) was placed in a spectrophotometer cuvette (1‐cm light path) at 37°C. The reaction was started by addition of 100 µL lysate and the rate of release of p‐nitroaniline was monitored at 410 nm (molar extinction coefficient 8,800) using a spectrophotometer (UV−160A; Shimadzu, Tokyo, Japan). The activity is expressed in units, where 1 unit is defined as the amount of enzyme required to release 1 µmol p‐nitroaniline·min−1. The specific activity is expressed in units·mg protein−1.

Determination of GGT and GGTRE messenger ribonucleic acid expression by RT-PCR

Extraction of total ribonucleic acid (RNA) from cells was performed as described previously 26. After incubation, cells were lysed using Isogen. After addition of chloroform and centrifugation (15 min at 12,000×g), the aqueous phase was collected. The sample was centrifuged again (15 min at 12,000×g) after addition of isopropanol. After addition of 75% ethanol, the sample was again centrifuged (5 min at 12,000×g). The pellet contained total RNA. The extracted total RNA was dissolved in DEPC-treated water and quantified by measurement of absorbance at 260 nm using a spectrophotometer (DU-600; Beckman, Irvine, CA, USA). Complementary DNA was synthesised by reverse transcription. The reaction mixture (20 µL) contained 1 µg total RNA, 11 µg oligodeoxythymidine primer, 4 µL 5×reaction buffer, 2 µL 0.25 M dithiothreitol, 4 µL dNTP mixture (each 2.5 M), 1 µL RNA guard (5 units), 1 µL RT (200 units) and DEPC-treated water. PCR was performed for 27 cycles of denaturation for 30 s at 94°C, annealing for 30 s at 56°C and extension for 1 min at 72°C. The following primers were used: GGT: 5′‐CCAGGACGGCCAGGTCCG‐3′ and 5′‐CGATGAAGGTGGACGCGAT‐3′ 27–29; GGTRE: 5′‐ACAGGGAAGGTGGAGGTCATC‐3′ and 5′‐GTCTCTACAAGGTGGTGGTAC‐3′ 15–17; and β‐actin: 5′‐TCCTGTGGCATCACGAAACT‐3′ and 5′‐TAGCAGGTGGCGTTTACGAAG‐3′. The sizes of the PCR products were 245 bp for GGT, 680 bp for GGTRE and 314 bp for β‐actin. The PCR products were electrophoresed and then stained using ethidium bromide. Messenger RNA (mRNA) abundance was visualised and photographed using an image analyser (Image Master VDS; Pharmacia Biotech, Tokyo, Japan). The levels of PCR products were analysed using a National Institutes of Health image program and compared with that of the β‐actin PCR product as an internal control. For every PCR experiment, preliminary experiments were performed to identify the optimum number of cycles of amplification to avoid saturation of the PCR products.

Statistical analysis

Data are presented as mean±sem. Statistical analysis was performed by one-way analysis of variance. A p‐value of <0.05 was regarded as significant.

Results

Effect of dexamethasone on LTC4 catabolism in 16HBE cells (cell-free study)

The effect of DEX on LTC4 catabolism was examined under cell-free conditions using the cell lysate as an enzyme source and LTC4 as the substrate. As shown in figure 1a⇓, DEX (1×10−7 M) time-dependently increased the conversion of exogenous LTC4 to LTD4 and LTE4, which was significant after a 1‐day incubation. In a dose/response study, DEX (pretreatment 2 days) dose-dependently increased the conversion of exogenous LTC4 to LTD4 and LTE4. Production of LTD4 and LTE4 in the control (DEX-free) was 26.5±1.0 and 6.6±0.3 ng·mg·protein−1·60 min−1, respectively, and was increased to 69.7±1.3 and 34.8±0.6 ng·mg·protein−1·60 min−1, respectively, by pretreatment with 1×10−7 M DEX (fig. 1b⇓).

Fig. 1.—
Fig. 1.—

Effect of dexamethasone (DEX) on leukotriene (LT)C4 catabolism in transformed human bronchial epithelial (16HBE) cells in a) time course (1×10−7 M DEX) and b) dose/response (DEX pretreatment 2 days) cell-free studies. The cells were pretreated with varying concentrations of DEX for different periods of time. The cell lysate was then prepared and incubated with exogenous LTC4 as the substrate at 37°C. The supernatant was recovered and the levels of LTD4 (•) and LTE4 (□) were measured by high-performance liquid chromatography. Data are presented as mean±sem (n=4). *: p<0.05 versus control.

Effect of dexamethasone on LTC4 metabolism in intact 16HBE cells

The effects of DEX on the enzymatic conversion of exogenous LTC4 to LTE4 in 16HBE cells were determined by HPLC. LTC4 synthesis was not detected in 16HBE cells without exogenous LTC4 (data not shown). Figure 2a⇓ shows the retention times of LTC4, LTD4 and LTE4 standards. LTC4 was stable during a 4‐h incubation in reaction buffer without cells (fig. 2b⇓). LTC4 was converted to LTD4 but not to LTE4 after a 4‐h incubation with cells not pretreated with DEX (fig. 2c⇓). When cells were pretreated with DEX (1×10−7 M) for 2 days, transformation of LTC4 to LTD4 was greater than that shown by the control, and LTD4 was further metabolised to LTE4 (fig. 2d⇓).

Fig. 2.—
Fig. 2.—

Effect of dexamethasone (DEX) on leukotriene (LT)C4 catabolism in intact transformed human bronchial epithelial (16HBE) cells. LT concentrations were measured by high-performance liquid chromatography. a) Retention of LTC4 (#: ∼6 min), LTD4 (: ∼8 min) and LTE4 (+: ∼9 min) standards. 100 ng exogenous LTC4 was incubated for 4 h with b) medium without cells, c) cells not pretreated with DEX and d) cells pretreated with 1×10−7 M DEX for 2 days. When cells were pretreated with DEX, transformation of LTC4 to LTD4 was greater than that shown by the control, and LTD4 was further metabolised to LTE4.

The time course of transformation of LTC4 to LTE4 in intact cells with or without DEX (1×10−7 M) pretreatment for 2 days is shown in figure 3⇓. After 4‐ and 6‐h incubations with LTC4, production of LTE4 was significantly greater in the cells pretreated with DEX (32.0±2.5 and 41.1±2.1 ng·mL−1) than in those without DEX (4.0±2.6 and 13.5±1.3 ng·mL−1, n=4; p<0.05).

Fig. 3.—
Fig. 3.—

Effect of dexamethasone (DEX) on conversion of leukotriene (LT)C4 to LTE4 in intact cells. Cells were pretreated with (•) or without (○) 1×10−7 M DEX for 2 days, and then 100 ng exogenous LTC4 was added and the cells incubated for varying periods of time (0–6 h). LT concentrations were measured by high-performance liquid chromatography. The levels of LTE4 in the group pretreated with DEX are significantly higher than in that without DEX after a 4‐h incubation. Data are presented as mean±sem (n=4). *: p<0.05 versus control.

Effect of dexamethasone on GGT activity in 16HBE cells

The effect of DEX on GGT activity was determined by rate-kinetic assay of p‐nitroaniline using cell lysate as an enzyme source and l‐γ‐glutamyl‐p‐nitroanilide and glycylglycine as substrates. As shown in figure 4a⇓, the activity of GGT without DEX pretreatment was 5.3±0.9 U·mg·protein−1. DEX showed no significant effect on GGT activity. GGT activity tended to decline at higher concentrations of DEX, although this was not significant (fig. 4b⇓).

Fig. 4.—
Fig. 4.—

Effect of dexamethasone (DEX) on γ‐glutamyl transpeptidase (GGT) activity in transformed human bronchial epithelial (16HBE) cells in a) time course (1×10−7 M DEX) and b) dose/response (DEX pretreatment 2 days) cell-free studies. After incubation of cells with varying concentrations of DEX for different periods of time, the cell lysate was prepared and incubated with l‐γ‐glutamyl‐p‐nitroanilide and glycylglycine as substrates at 37°C. The release of p‐nitroaniline, measured spectrophotometrically at 410 nm, indicates GGT activity. There was no significant effect of DEX. Data are presented as mean±sem (n=4). #: p=0.07 versus control; : p=0.08 versus control.

Effect of dexamethasone on GGT and GGTRE messenger ribonucleic acid expression in 16HBE cells

GGT and GGTRE mRNA expression were examined using RT-PCR analysis. As shown in figure 5a⇓, GGTRE mRNA levels were obviously enhanced after incubation with 1×10−7 M DEX for 2 days. GGT mRNA expression was not changed by DEX pretreatment. GGTRE mRNA density normalised to β‐actin was significantly increased from 0.12±0.03 to 0.90±0.11 by DEX (fig. 5b⇓). GGT mRNA density was not significantly changed by DEX pretreatment (fig. 5c⇓).

Fig. 5.—
Fig. 5.—

Effect of dexamethasone (DEX) on γ‐glutamyl transpeptidase (GGT) and GGT-related enzyme (GGTRE) messenger ribonucleic acid (mRNA) expression in transformed human bronchial epithelial (16HBE) cells. After incubation of cells with or without 1×10−7 M DEX for 2 days, total ribonucleic acid was isolated and reverse transcriptase-polymerase chain reaction (RT-PCR) performed for GGT and GGTRE mRNA. a) Electrophoresis of GGTRE (680 base pairs (bp)), GGT (245 bp) and β‐actin (314 bp) RT-PCR products (lanes 1 and 2: control; lanes 3 and 4: DEX pretreatment). Densitometric analysis of b) GGTRE and c) GGT RT-PCR products normalised to β‐actin. Data are presented as mean±sem (n=4). *: p<0.05 versus control.

Effect of dexamethasone on LTD4 catabolism in 16HBE cells

The effect of DEX on the transformation of LTD4 to LTE4, via a dipeptidase-like activity, using the cell lysate as an enzyme source and LTD4 as a substrate was examined. LTD4 catabolism in 16HBE cells without DEX pretreatment was 80.6±6.2 ng·mg·protein−1·60 min−1. LTD4 catabolism tended to increase after incubation with ≥1×10−7 M DEX for >2 days, but this was not significant (data not shown).

Effect of dexamethasone on LTC4 catabolism, GGT activity, and GGT and GGTRE messenger ribonucleic acid expression in normal human bronchial epithelial cells

The above effects were further examined in NHBE cells. As shown in figure 6a and b⇓, the conversion of exogenous LTC4 to LTD4 and LTE4 was significantly enhanced after incubation with 1×10−7 M DEX for 2 days. The concentrations of LTD4 and LTE4 in the control (DEX-free) were 50.3±2.4 and 20.4±0.9 ng·mg·protein−1·60 min−1, respectively, which increased to 63.4±2.3 and 32.2±2.0 ng·mg·protein−1·60 min−1, respectively, with DEX pretreatment. GGT activity was not significantly changed by DEX pretreatment (fig. 6c⇓).

Fig. 6.—
Fig. 6.—

Effect of dexamethasone (DEX) on leukotriene (LT)C4 catabolism and γ‐glutamyl transpeptidase (GGT) activity in normal human bronchial epithelial (NHBE) cells. Conversion of exogenous LTC4 to a) LTD4 and b) LTE4. c) GGT activity after incubation of NHBE cells with or without 1×10−7 M DEX for 2 days. Data are presented as mean±sem (n=4). *: p<0.05 versus control.

As shown in figure 7a⇓, GGTRE mRNA expression in NHBE cells was obviously enhanced after incubation with 1×10−7 M DEX for 2 days. GGT mRNA expression was not changed by DEX pretreatment. GGTRE mRNA density normalised to β‐actin was significantly increased from 0.53±0.05 to 0.79±0.05 by DEX (fig. 7b⇓). GGT mRNA density was not significantly changed by DEX pretreatment (fig. 7c⇓).

Fig. 7.—
Fig. 7.—

Effect of dexamethasone (DEX) on γ‐glutamyl transpeptidase (GGT) and GGT-related enzyme (GGTRE) messenger ribonucleic acid (mRNA) expression in normal human bronchial epithelial (NHBE) cells. After incubation of NHBE cells with or without 1×10−7 M DEX for 2 days, total ribonucleic acid was isolated and reverse transcriptase-polymerase chain reaction (RT-PCR) performed for GGT and GGTRE mRNA. a) Electrophoresis of GGTRE (680 base pairs (bp)), GGT (245 bp) and β‐actin (314 bp) RT-PCR products (lanes 1 and 2: control; lanes 3 and 4: DEX pretreatment). Densitometric analysis of b) GGTRE and c) GGT RT-PCR products normalised to β‐actin. Data are presented as mean±sem (n=4). *: p<0.05 versus control.

Discussion

In the present study, it was found that DEX pretreatment accelerated the conversion of LTC4 to LTE4 via LTD4 in human airway epithelial cells; this was attributable to a new induction of GGTRE.

Among cysLTs, LTE4 is biologically less active than LTC4 and LTD4, therefore, the transformation of LTC4 to LTE4 is an important aspect in the treatment of bronchial asthma. LTC4 is metabolised to LTE4 in two consecutive reactions catalysed by enzymes of the glutamyl transpeptidase and dipeptidase families. GGT (EC 2.3.2.2) is an extracellular membrane-bound heterodimer that catalyses the transfer of the γ‐glutamyl group from glutathione and other γ‐glutamyl‐containing compounds to an acceptor amino acid structure 13, 14, 30. In the LTC4-degrading pathway, GGT cleaves the γ‐glutamyl residue of LTC4 and transforms it to LTD4. In mammalian lungs, GGT is found on the apical membrane of Clara cells and type-II pneumocytes 1, 31. As shown in the present study, GGT-like enzyme activity is also present in bronchial epithelial cells, which are important sites in inactivation of LTC4.

It had been thought that GGT was the only enzyme to mediate the conversion of LTC4 to LTD4. Recently, however, another GGT-like activity was identified and cloned in humans, rats and mice 15–17, 32–34, and was named GGTRE or GGL. GGTRE shares a 40% overall amino acid sequence identity with GGT, and is capable of cleaving the γ‐glutamyl linkage of LTC4. However, it is unable to hydrolyse synthetic substrates commonly used for assaying GGT, such as l‐γ‐glutamyl‐p‐nitroanilide and glycylglycine, which indicates that GGTRE is more specific for the catabolism of LTC4. In the present study, the extent of GGTRE but not GGT mRNA expression was upregulated by DEX pretreatment, which was associated with increased LTC4-degrading activity. These results strongly suggest a new induction of GGTRE at the transcriptional level, although new protein synthesis was not confirmed. GGTRE is induced by epidermal growth factor in rat tracheal cells, and by DEX in HepG2 (hepatoblastoma cell line) cells 15, 33. GGTRE was also induced by chemical exposures, such as isobutyl nitrite in rat tracheal cells 33. Thus, GGTRE is an inducible enzyme that occurs in various species and cell types.

Inhaled glucocorticosteroids are the gold standard as controller medicines for the treatment of bronchial asthma 35, 36. Glucocorticosteroids bind to an intracellular receptor and form a receptor complex that rapidly translocates to the nucleus. The receptor complex interacts with transcription factors, such as nuclear factor-κB and activator protein−1. These transcription factors activate gene transcription. Glucocorticosteroids are involved in their effects on transcription of genomic DNA by modifying the action of transcription factors. Whatever the final mechanisms, glucocorticosteroids are believed to have profound inhibitory effects on the production of allergy-related T‐helper cell type‐2‐derived inflammatory cytokines such as interleukin‐4, ‐5 and −13 36. Although this is a substantial mechanism of glucocorticosteroids in their effectiveness against asthma, much remains unknown about their therapeutic effectiveness. In human airway epithelial cells, glucocorticosteroids regulate inflammation in asthma by transcriptionally upregulating peptidase genes such as neutral endopeptidase and aminopeptidase N, which inactivate substance P and other inflammatory tachykinins 37–39. The present finding that DEX activates the LTC4-degrading pathway by a new induction of GGTRE is an additional mechanism that influences the effectiveness of inhaled glucocorticosteroids in bronchial asthma.

In clinical studies, it was shown that oral predonisolone given to patients with asthma reduced their symptoms, but failed to reduce the levels of LTE4 in bronchoalveolar lavage fluid and urine and those of cysLTs in sputum 40–42. It was also shown that fluticasone propionate significantly inhibited early and late responses to allergen in patients with mild asthma, but did not significantly change the increase in urinary excretion of LTE4 caused by allergen challenge 43. These investigators speculated that glucocorticosteroids had no significant effect on the metabolism of cysLTs in human bronchial asthma. However, the present results suggest that glucocorticosteroids can reduce clinical symptoms by accelerating the process of inactivation of bioactive LTC4 to the less active LTE4. It was reported that responsiveness to LTC4 and LTD4 in isolated human tracheal strips was potentiated by l‐serine/borate, a GGT inhibitor, and/or l‐cysteine, a dipeptidase inhibitor, and that it was also enhanced by the removal of the airway epithelium, since transformation of LTC4 to LTE4 via LTD4 by these two catabolic enzymes was attenuated by these enzyme inhibitors or by the removal of the epithelium where the catabolic enzymes were located 44–46. In the present study, DEX accelerated the conversion of LTC4 to LTD4 by upregulating GGTRE, resulting in rapid inactivation of LTC4 and LTD4, which are more potent cysLTs than LTE4. If bronchial epithelial cells do not have sufficient activity to convert LTD4 to LTE4, glucocorticosteroid may enhance the action of cysLTs. Thus, the activation and/or inactivation of the LTC4-degrading pathway is an important consideration in the treatment of bronchial asthma.

In conclusion, dexamethasone accelerated the process of inactivation of leukotriene C4 to leukotriene E4 by inducing new γ‐glutamyl transpeptidase-related enzyme activity in 16HBE-transformed human bronchial epithelial cells and normal human bronchial epithelial cells at the transcriptional level. These results indicate that the therapeutic effectiveness of glucocorticosteroids is, at least partially, attributable to this novel mechanism of glucocorticosteroids on the metabolism of the cysteinyl leukotriene-degrading pathway. Since the present data are from an in vitro study using a high dose of exogenous leukotriene C4, it may not accurately reflect cysteinyl leukotriene degradation in the physiological state. Further studies, especially in vivo studies, on the regulation of the cysteinyl leukotriene-degrading pathway are, therefore, needed.

  • Received January 21, 2002.
  • Accepted February 3, 2003.

References

  1. ↵
    Drazen JM, Austen KF. Leukotrienes and airway responses. Am Rev Respir Dis 1987;136:985–998.
    OpenUrlPubMedWeb of Science
  2. ↵
    Barnes PJ, Chung KF, Page CP. Inflammatory mediators and asthma. Pharmacol Rev 1988;40:49–84.
    OpenUrlPubMedWeb of Science
  3. ↵
    Drazen JM. Leukotrienes as mediators of airway obstruction. Am J Respir Crit Care Med 1998;158:S193–S200.
    OpenUrlCrossRefPubMedWeb of Science
  4. Smith LJ, Greenberger PA, Patterson R, Krell RD, Bernstein PR. The effect of inhaled leukotriene D4 in humans. Am Rev Respir Dis 1985;131:368–372.
    OpenUrlPubMedWeb of Science
  5. Marom Z, Shelhamer JH, Bach MK, Morton DR, Kaliner M. Slow-reacting substances, leukotrienes C4 and D4, increase the release of mucus from human airways in vitro. Am Rev Respir Dis 1982;126:449–451.
    OpenUrlPubMedWeb of Science
  6. Dahlen SE, Bjork J, Hedqvist P, et al. Leukotrienes promote plasma leakage and leukocyte adhesion in postcapillary venules: in vivo effects with relevance to the acute inflammatory response. Proc Natl Acad Sci USA 1981;78:3887–3891.
    OpenUrlAbstract/FREE Full Text
  7. ↵
    O'Byrne PM. Eicosanoids and asthma. Ann NY Acad Sci 1994;744:251–261.
    OpenUrlCrossRefPubMedWeb of Science
  8. ↵
    Dahlen SE, Hedqvist P, Hammarstrom S, Samuelsson B. Leukotrienes are potent constrictors of human bronchi. Nature 1980;288:484–486.
    OpenUrlCrossRefPubMed
  9. ↵
    Hanna CJ, Bach MK, Pare PD, Schellenberg RR. Slow-reacting substances (leukotrienes) contract human airway and pulmonary vascular smooth muscle in vitro. Nature 1981;290:343–344.
    OpenUrlCrossRefPubMed
  10. ↵
    Drazen JM, Israel E, O'Byrne PM. Treatment of asthma with drugs modifying the leukotriene pathway. N Engl J Med 1999;340:197–206.
    OpenUrlCrossRefPubMedWeb of Science
  11. ↵
    Lipworth BJ. Leukotriene-receptor antagonists. Lancet 1999;353:57–62.
    OpenUrlCrossRefPubMedWeb of Science
  12. ↵
    O'Byrne PM. Leukotriene bronchoconstriction induced by allergen and exercise. Am J Respir Crit Care Med 2000;161:S68–S72.
    OpenUrlCrossRefPubMedWeb of Science
  13. ↵
    Orning L, Hammarstrom S. Inhibition of leukotriene C and leukotriene D biosynthesis. J Biol Chem 1980;255:8023–8026.
    OpenUrlAbstract/FREE Full Text
  14. ↵
    Bernstrom K, Hammarstrom S. Metabolism of leukotriene D by porcine kidney. J Biol Chem 1981;256:9579–9582.
    OpenUrlAbstract/FREE Full Text
  15. ↵
    Heisterkamp N, Rajpert-De Meyts E, Uribe L, Forman HJ, Groffen J. Identification of a human γ‐glutamyl cleaving enzyme related to, but distinct from, γ‐glutamyl transpeptidase. Proc Natl Acad Sci USA 1991;88:6303–6307.
    OpenUrlAbstract/FREE Full Text
  16. ↵
    Carter BZ, Shi ZZ, Barrios R, Lieberman MW. γ‐Glutamyl leukotrienase, a γ‐glutamyl transpeptidase gene family member, is expressed primarily in spleen. J Biol Chem 1998;273:28277–28285.
    OpenUrlAbstract/FREE Full Text
  17. ↵
    Habib GM, Lieberman MW. Cleavage of leukotriene D4 in mice with targeted disruption of a membrane-bound dipeptidase gene. Adv Exp Med Biol 1999;469:295–300.
    OpenUrlPubMedWeb of Science
  18. Kozak EM, Tate SS. Glutathione-degrading enzymes of microvillus membranes. J Biol Chem 1982;257:6322–6327.
    OpenUrlAbstract/FREE Full Text
  19. Christie PE, Schmitz-Schumann M, Spur BW, Lee TH. Airway responsiveness to leukotriene C4 (LTC4), leukotriene E4 (LTE4) and histamine in aspirin-sensitive asthmatic subjects. Eur Respir J 1993;6:1468–1473.
    OpenUrlAbstract/FREE Full Text
  20. ↵
    Zaitsu M, Hamasaki Y, Aoki Y, Miyazaki S. A novel pharmacologic action of glucocorticosteroids on leukotriene C4 catabolism. J Allergy Clin Immunol 2001;108:122–124.
    OpenUrlCrossRefPubMedWeb of Science
  21. ↵
    Cozens AL, Yezzi MJ, Kunzelmann K, et al. CFTR expression and chloride secretion in polarized immortal human bronchial epithelial cells. Am J Respir Cell Mol Biol 1994;10:38–47.
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    Gruenert DC, Finkbeiner WE, Widdicombe JH. Culture and transformation of human airway epithelial cells. Am J Physiol 1995;268:L347–L360.
  23. ↵
    Aoki Y, Qiu D, Zhao GH, Kao PN. Leukotriene B4 mediates histamine induction of NF-κB and IL‐8 in human bronchial epithelial cells. Am J Physiol 1998;274:L1030–L1039.
  24. ↵
    Hartree EF. Determination of protein: a modification of the Lowry method that gives a linear photometric response. Anal Biochem 1972;48:422–427.
    OpenUrlCrossRefPubMedWeb of Science
  25. ↵
    Meister A, Tate SS, Griffith OW. γ‐Glutamyl transpeptidase. Methods Enzymol 1981;77:237–253.
    OpenUrlCrossRefPubMed
  26. ↵
    Zaitsu M, Hamasaki Y, Matsuo M, et al. New induction of leukotriene A4 hydrolase by interleukin‐4 and interleukin−13 in human polymorphonuclear leukocytes. Blood 2000;96:601–609.
    OpenUrlAbstract/FREE Full Text
  27. ↵
    Goodspeed DC, Dunn TJ, Miller CD, Pitot HC. Human γ‐glutamyl transpeptidase cDNA: comparison of hepatoma and kidney mRNA in the human and rat. Gene 1989;76:1–9.
    OpenUrlCrossRefPubMedWeb of Science
  28. Rajpert-De Meyts E, Heisterkamp N, Groffen J. Cloning and nucleotide sequence of human γ‐glutamyl transpeptidase. Proc Natl Acad Sci USA 1988;85:8840–8844.
    OpenUrlAbstract/FREE Full Text
  29. ↵
    Pawlak A, Cohen EH, Octave JN, et al. An alternatively processed mRNA specific for γ‐glutamyl transpeptidase in human tissues. J Biol Chem 1990;265:3256–3262.
    OpenUrlAbstract/FREE Full Text
  30. ↵
    Sok DE, Pai JK, Atrache V, Sih CJ. Characterization of slow reacting substances (SRSs) of rat basophilic leukemia (RBL−1) cells: effect of cysteine on SRS profile. Proc Natl Acad Sci USA 1980;77:6481–6485.
    OpenUrlAbstract/FREE Full Text
  31. ↵
    Dinsdale D, Green JA, Manson MM, Lee MJ. The ultrastructural immunolocalization of γ‐glutamyltranspeptidase in rat lung: correlation with the histochemical demonstration of enzyme activity. Histochem J 1992;24:144–152.
    OpenUrlCrossRefPubMedWeb of Science
  32. Carter BZ, Wiseman AL, Orkiszewski R, Ballard KD, Ou CN, Lieberman MW. Metabolism of leukotriene C4 in γ‐glutamyl transpeptidase-deficient mice. J Biol Chem 1997;272:12305–12310.
    OpenUrlAbstract/FREE Full Text
  33. ↵
    Potdar PD, Andrews KL, Nettesheim P, Ostrowski LE. Expression and regulation of γ‐glutamyl transpeptidase-related enzyme in tracheal cells. Am J Physiol 1997;273:L1082–L1089.
  34. ↵
    Shi ZZ, Han B, Habib GM, Matzuk MM, Lieberman MW. Disruption of γ‐glutamyl leukotrienase results in disruption of leukotriene D4 synthesis in vivo and attenuation of the acute inflammatory response. Mol Cell Biol 2001;21:5389–5395.
    OpenUrlAbstract/FREE Full Text
  35. ↵
    Lenfant C, Khaltaeu N.. Global Initiative for Asthma: Global Strategy for Asthma Management and Prevention. NHLBI/WHO Workshop ReportBethesda, National Institutes of Health, 1995.
  36. ↵
    Barnes PJ, Pedersen S, Busse WW. Efficacy and safety of inhaled corticosteroids: new developments. Am J Respir Crit Care Med 1998;157:S1–S53.
    OpenUrlCrossRefPubMedWeb of Science
  37. ↵
    Lang Z, Murlas CG. Neutral endopeptidase of a human airway epithelial cell line recovers after hypochlorous acid exposure: dexamethasone accelerates this by stimulating neutral endopeptidase mRNA synthesis. Am J Respir Cell Mol Biol 1992;7:300–306.
  38. Sont JK, van Krieken JH, van Klink HC, et al. Enhanced expression of neutral endopeptidase (NEP) in airway epithelium in biopsies from steroid- versus nonsteroid-treated patients with atopic asthma. Am J Respir Cell Mol Biol 1997;16:549–556.
    OpenUrlPubMedWeb of Science
  39. ↵
    van der Velden VH, Naber BA, van der Spoel P, Hoogsteden HC, Versnel MA. Cytokines and glucocorticoids modulate human bronchial epithelial cell peptidases. Cytokine 1998;10:55–65.
    OpenUrlCrossRefPubMedWeb of Science
  40. ↵
    Sebaldt RJ, Sheller JR, Oates JA, Roberts LJ 2nd, FitzGerald GA. Inhibition of eicosanoid biosynthesis by glucocorticoids in humans. Proc Natl Acad Sci USA 1990;87:6974–6978.
    OpenUrlAbstract/FREE Full Text
  41. Dworski R, Fitzgerald GA, Oates JA, Sheller JR. Effect of oral prednisone on airway inflammatory mediators in atopic asthma. Am J Respir Crit Care Med 1994;149:953–959.
    OpenUrlPubMedWeb of Science
  42. ↵
    Pavord ID, Ward R, Woltmann G, Wardlaw AJ, Sheller JR, Dworski R. Induced sputum eicosanoid concentrations in asthma. Am J Respir Crit Care Med 1999;160:1905–1909.
    OpenUrlPubMedWeb of Science
  43. ↵
    O'Shaughnessy KM, Wellings R, Gillies B, Fuller RW. Differential effects of fluticasone propionate on allergen-evoked bronchoconstriction and increased urinary leukotriene E4 excretion. Am Rev Respir Dis 1993;147:1472–1476.
    OpenUrlPubMedWeb of Science
  44. ↵
    Yamaya M, Sekizawa K, Yamauchi K, Hoshi H, Sawai T, Sasaki H. Epithelial modulation of leukotriene‐C4‐induced human tracheal smooth muscle contraction. Am J Respir Crit Care Med 1995;151:892–894.
    OpenUrlPubMedWeb of Science
  45. Funayama T, Sekizawa K, Yamaya M, et al. Role of leukotriene-degrading enzymes in pulmonary response to antigen infusion in sensitized guinea pigs in vivo. Am J Respir Cell Mol Biol 1996;15:260–267.
    OpenUrlPubMedWeb of Science
  46. ↵
    Yamaya M, Sekizawa K, Terajima M, Okinaga S, Ohrui T, Sasaki H. Dipeptidase inhibitor and epithelial removal potentiate leukotriene D4‐induced human tracheal smooth muscle contraction. Respir Physiol 1998;111:101–109.
    OpenUrlCrossRefPubMedWeb of Science
Back to top
View this article with LENS
Email
Print
Citation Tools

Dexamethasone accelerates catabolism of leukotriene C4 in bronchial epithelial cells
M. Zaitsu, Y. Hamasaki, K. Tsuji, M. Matsuo, I. Fujita, Y. Aoki, E. Ishii, O. Kohashi
European Respiratory Journal Jul 2003, 22 (1) 35-42; DOI: 10.1183/09031936.03.00004402
del.icio.us logo Digg logo Reddit logo Technorati logo Twitter logo CiteULike logo Connotea logo Facebook logo Google logo Mendeley logo
Full Text (PDF)

Jump To