Binding of the ELAV-like protein in murine autoimmune T-cells to the nonameric AU-rich element in the 3′ untranslated region of CD154 mRNA
Introduction
The CD154 molecule, the ligand for CD40, is expressed primarily by activated CD4+ T-cells, and its binding to the CD40 molecules on antigen presenting cells mediates both humoral and cell-mediated immune responses. experimental allergic encephalomyelitis (EAE), an animal model for multiple sclerosis, is an autoimmune disease mediated by the autoimmune CD4+ T-cells. The expression of the CD154 molecules on the EAE autoimmune T-cells is crucial for their encephalitogenicity (Ford et al., 1999a, Abromson-Leeman et al., 2001). The previous studies have revealed that the CD154 knockout mice fail to develop clinical EAE (Grewal et al., 1996), that interruption of CD40–CD154 signaling limits the clinical course of EAE (Gerritse et al., 1996), and that blockade of CD40–CD154 interactions directly interferes with the effector functions of effector cells (Howard and Miller, 2001).
The CD154 expression is regulated in part by post-transcriptional mechanisms (Ford et al., 1999a, Rigby et al., 1999, Suarez et al., 1997, Barnhart et al., 2000). For post-transcriptional regulation, the instabilizing/stabilizing elements in the 3′ untranslated region (3′UTR) of mRNA play crucial roles. These elements are bound by transacting proteins and thereby stabilize or destabilize the mRNA. The adenylate uridylate rich element (ARE) is one of the instability elements (Shyu et al., 1991, Winstall et al., 1995). CD154 mRNA contains scattered four copies of the pentameric ARE, AUUUA, and a single copy of the nonameric ARE, UUAUUUAUU, in the 3′UTR. Previous studies have indicated that there are no proteins that bind to the pentameric AREs of CD154 mRNA in T-cells (Rigby et al., 1999, Barnhart et al., 2000). However, it has not been determined whether the protein that binds to the nonameric ARE of CD154 mRNA exists or not in T-cells. Previous study has shown that the nonameric ARE but not the pentameric ARE is the minimal ARE that effectively destabilizes mRNA (Zubiaga et al., 1995). In this communication, we have examined the CD154 nonameric ARE-binding protein in the autoimmune T-cells established from the EAE mice.
Section snippets
Peptides, synthetic ribonucleotides and antibodies
Rat myelin basic protein (MBP) peptide p89–101 was synthesized by Kurabo Industries, Ltd. (Osaka, Japan). Anti-HuR antibodies was purchased from SantaCruz Biotechnology Inc. (Santa Cruz, CA, USA). Poly(U) and poly(A) synthetic ribonucleotide homopolymers were purchased from Pharmacia Co. Ltd. (Peapack, NJ, USA). The oligoribonucleotide containing the nonameric ARE in the 3′UTR of CD154 mRNA (CUUGUUAUUUAUUUUUUGAA) and the ARE in the 3′UTR of tumor necrosis factor-α (TNF-α) mRNA
Results
To identify the protein which binds to the nonameric ARE in the 3′UTR of CD154 mRNA, we examined binding of the oligoribonucleotide containing the nonameric ARE to a nuclear extract prepared from the MBP-reactive autoimmune cloned T-cells by REMSA. As shown in Fig. 1A, a single protein–RNA complex was detected in the nuclear extract. The ELAV-like proteins are known to bind to some AREs. Among four ELAV-like proteins, mHuR is the only protein expressed in cells of lymphoid lineage (Ma et al.,
Discussion
The overall control of CD154 expression during T-cell activation is post-transcriptionally regulated by transacting binding proteins. Determination of the binding proteins to the instabilizing/stabilizing elements of CD154 mRNA is important to clarify the post-transcriptional regulatory mechanisms of CD154 expression. Several proteins, which can bind to the instabilizing/stabilizing elements in the 3′UTR of the CD154 mRNA, have been documented in T-cells. Barnhart et al. described that a 90 kDa
Conclusions
The ELAV-like protein, mHuR, binds to the CD154 ARE in murine autoimmune T-cells activated with MBP. The ELAV-like protein may participate in the regulation of the expression of CD154 on the autoimmune T-cells.
Acknowledgements
We wish to thank Ms. Rie Hagihara for her secretarial assistance. This work was supported in part by a grant for Neuroimmunological Disease Research from the Ministry of Health and Welfare of Japan, and a grant for Project Research from High-Technology Center of Kanazawa Medical University (H2003-3).
References (20)
- et al.
Cloning and characterization of HuR, a ubiquitously expressed Elav-like protein
J. Biol. Chem.
(1996) - et al.
Binding of neuronal ELAV-like proteins to the uridine-rich sequence in the 3′-untranslated region of tumor necrosis factor-alpha messenger RNA
FEBS Lett.
(1999) - et al.
Analysis of the RNA recognition motifs of human neuronal ELAV-like proteins in binding to a cytokine mRNA
Biochem. Biophys. Res. Commun.
(1999) - et al.
CD40-mediated activation of T cells accelerates, but is not required for, encephalitogenic potential of myelin basic protein-recognizing T cells in a model of progressive experimental autoimmune encephalomyelitis
Eur. J. Immunol.
(2001) - et al.
ELAV protein HuA (HuR) can redistribute between nucleus and cytoplasm and is upregulated during serum stimulation and T cell activation
J. Cell. Sci.
(1998) - et al.
Identification of a complex that binds to the CD154 3′ untranslated region: implications for a role in message stability during T cell activation
J. Immunol.
(2000) - et al.
The 3′ untranslated region of tumor necrosis factor alpha mRNA is a target of the mRNA-stabilizing factor HuR
Mol. Cell Biol.
(2001) - et al.
Regulation of CD154 (CD40 ligand) mRNA stability during T cell activation
J. Immunol.
(1999) - et al.
ELAV proteins stabilize deadenylated intermediates in a novel in vitro mRNA deadenylation/degradation system
Genes Dev.
(1999) - et al.
CD40–CD40 ligand interactions in experimental allergic encephalomyelitis and multiple sclerosis
Proc. Natl. Acad. Sci. U.S.A.
(1996)
Cited by (14)
Ocrevus reduces TH40 cells, a biomarker of systemic inflammation, in relapsing multiple sclerosis (RMS) and in progressive multiple sclerosis (PMS)
2023, Journal of NeuroimmunologyCitation Excerpt :The CD40/CD154 dyad has been identified as important in autoimmune disease development and thus became an important therapeutic target (Wiesemann et al., 2008; Benveniste et al., 2004; Chitnis and Khoury, 2003; Howard et al., 2002; Howard et al., 1999; Mach et al., 1998; Kornbluth et al., 1998). The dyad has been linked to human MS (Peters et al., 2009; Sakai et al., 2003; Michel et al., 2014; Wheway et al., 2014; Wheway et al., 2013; Lisak et al., 2012; Kalinowska-Lyszczarz and Losy, 2012; Jagessar et al., 2012), and in mouse models disrupting CD40/CD154 interaction prophylactically prevents EAE while in RR-EAE it significantly (p < 0.01) improves disease scores (Howard et al., 1999; Girvin et al., 2002; Tan et al., 1998). We described CD40 on a subset of CD4+ cells that concomitantly produce IFNγ and IL-17 that were defined as T Helper – 40 (TH40) (Waid et al., 2008; Vaitaitis and Wagner Jr., 2008; Baker et al., 2008; Vaitaitis and Wagner Jr., 2010; Waid et al., 2007; Waid et al., 2004; Vaitaitis et al., 2003; Wagner Jr. et al., 2002; Wagner Jr., 2009).
Lessons from studying the AU-rich elements in chronic inflammation and autoimmunity
2019, Journal of AutoimmunityCitation Excerpt :Several studies indicated that HuR strongly moves to the cytoplasm and binds its targets upon TCR crosslinking, integrin mediated co-activation or co-stimulatory signaling [113,114]. In vitro studies suggested that HuR may be required for the expression of Cd3ζ and thus competent TCRs [115]; for Th2, Th17 and selected regulatory T-cells functions by enhancing the expression of IL-4 [116], IL-13 [117], GM-CSF [118] and CD83 [119]; for T-cell dependent B-cell responses by CD40 signaling [120]; and for activation-induced cell death via its control over the expression of FasL and the splicing of Fas alongside to TIA-1 [121]. Several T-cell restricted mutants of HuR have been employed to validate these data.
Silencing of the RNA-binding protein HuR attenuates hyperalgesia and motor disability in experimental autoimmune encephalomyelitis
2017, NeuropharmacologyCitation Excerpt :The CD154 molecule, the ligand for CD40, is expressed primarily by activated CD4+ T-cells, and the expression of the CD154 molecules on the EAE autoimmune T-cells is crucial for their encephalitogenicity (Abromson-Leeman et al., 2001). It has been reported that HuR binds to the CD154 ARE in murine autoimmune T-cells activated with myelin basic protein (MBP) and that mHuR was upregulated upon stimulation of the T-cells with a MBP antigen (Sakai et al., 2003). Thus, HuR may participate in the regulation of the expression of CD154 on the autoimmune T-cells.
HuR posttranscriptionally regulates early growth response-1 (Egr-1) expression at the early stage of T cell activation
2012, FEBS LettersCitation Excerpt :HuR is ubiquitously expressed but abundant in the thymus and spleen (predominantly in lymphocytic cells) [5,6]. It is not surprising that HuR has significant influence on adaptive immunity by its interactions with mRNAs encoding key immune regulators, including TNF-α, FasL, GM-CSF, IL-3, IL-4, IL-13, CD3ζ, CD83 and CD154 [7–14]. In the early stage of T cell activation induced by anti-TCR/CD28 or LFA-1, HuR rapidly shuttles from the nucleus to the cytoplasm [7,9].
FasL expression in activated T lymphocytes involves HuR-mediated stabilization
2010, Journal of Biological ChemistryCitation Excerpt :These include IFNγ, GM-CSF, CD83, TNFα, and CD40L (14–16). This regulation is due to the stabilization of these messages by a mechanism that involves their association with ARE-binding proteins such as HuR (12, 17, 18). HuR belongs to the ELAV (embryonic lethal abnormal vision) family of RNA-binding proteins that contains three other members, HuB, HuC, and HuD (19).
Coordinated post-transcriptional regulation of the chemokine system: Messages from CCL2
2014, Journal of Interferon and Cytokine Research