|
|
||||||||
release from human alveolar macrophages1 Depts of Molecular Biology, and 2 Medicinal Chemistry, AstraZeneca Research & Development Charnwood, Loughborough, UK.
CORRESPONDENCE: M. J. Ratcliffe, Dept of Molecular Biology, AstraZeneca Research and Development Charnwood, Bakewell Road, Loughborough, LE11 5RH, UK. Fax: 44 1509645557. E-mail: Marianne.ratcliffe{at}astrazeneca.com
Keywords: Alveolar, cytokine, human, macrophage, prostaglandin E2
Received: October 9, 2006
Accepted February 18, 2007
| ABSTRACT |
|---|
|
|
|---|
MDMs were obtained by in vitro differentiation of monocytes from the peripheral blood of healthy human volunteers. Human AMs were obtained by perfusion of lung tissue from carcinoma resection patients.
In MDMs, PGE2 potently inhibited lipopolysaccharide-induced tumour necrosis factor (TNF)-
release (p[A]50 8.51±0.11, maximum inhibition 95.9±4.8%). In human AMs, PGE2 also inhibited TNF-
release but the observed concentrationeffect curve was very flat and inhibition was incomplete. The shape of the PGE2 curve in AMs suggested that its effects were mediated by activation of a heterogeneous receptor population. Expression studies combined with the use of various E-prostanoid (EP) receptor agonists and a selective EP4-receptor antagonist (Ono-AE2-227) confirmed that the inhibitory effects of PGE2 in both AMs and MDMs were mediated by activation of EP4 and EP2 receptors.
These data indicate that both E-prostanoid4 and E-prostanoid2 selective agonists may have anti-inflammatory properties in lung diseases where macrophages play a role.
Alveolar macrophages (AMs) are a key component of innate immune defence in the lungs. AMs remove inhaled material, including particulates and microorganisms, via phagocytosis and by releasing a wide range of mediators which recruit other cells, notably neutrophils, into the lungs. This pro-inflammatory response is important in clearing foreign agents but it has been hypothesised that in certain conditions it is excessive, leading to the destruction of host tissues and the development of chronic inflammatory disease 1. This has promoted considerable interest in the discovery of pharmacological agents that dampen down the release of pro-inflammatory mediators from macrophages.
One such agent is prostaglandin (PG)E2 which elicits a range of biological effects via its interaction with G-protein coupled receptors, designated E-prostanoid (EP)1, EP2, EP3 and EP4 2. EP receptors all have a high affinity for PGE2 but differ in their affinities for various synthetic agonists and antagonists 3, 4. PGE2 has been shown to affect many macrophage functions, including tumouricidal activity 5, 6, phagocytosis 7, 8 and mediator release 913. The effects of PGE2 on mediator release are generally considered to be anti-inflammatory, as PGE2 has been demonstrated to inhibit the release of a number of cytokines and chemokines, whilst inducing expression of the anti-inflammatory cytokine interleukin (IL)-10 14, 15. These observations suggest that it may be possible to develop EP receptor agonists as therapeutic drugs to treat inflammatory diseases. However, few studies have assessed the effects of such agents on human AMs. PGE2-mediated inhibitions of IL-1 16, IL-8 17, tumour necrosis factor (TNF)-
18 and fibronectin 10 have been reported in these cells but the receptor type(s) mediating these responses were not investigated. The aim of the present study was, therefore, to address this issue and by doing so, provide information on the potential efficacy of EP agonists as anti-inflammatory drugs for pulmonary diseases, such as chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis or acute respiratory distress syndrome.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Generation of human embryonic kidney cells stably transfected with the human EP2 or EP4 receptor
The human EP2 and EP4 cDNA sequences were cloned into the mammalian expression vector pIRESneo2 (Clontech Laboratories Inc., Mountain View, CA, USA). Plasmid DNA was transfected into human embryonic kidney (HEK) cells using FuGENE 6 transfection reagent (Roche Molecular Systems, Inc., Alameda, CA, USA) and expressing cells were selected using 1 mg·mL1 geneticin solution. Specific cell surface expression of EP2 or EP4 was confirmed by antibody staining (data not shown).
Preparation of macrophages
Human monocyte-derived macrophages (MDMs) were prepared from peripheral blood monocytes isolated from healthy human volunteers. Venous blood was layered onto lymphoprep (Axis-Shield UK, Kimbolten, UK) and centrifuged at 800xg for 20 min with no brake. The mononuclear cell layer was removed and platelet contamination was removed by several low-speed (80xg) centrifugation/wash steps using 5% volume (v)/v autologous serum in 0.9% weight (w)/v NaCl. Monocytes were prepared by negative selection using human monocyte isolation kit II (Miltenyi Biotec, Surrey, UK), according to the manufacturer's instructions. Cells were cultured in IMDM/10% v/v FCS/penicillin (100 U·mL1)/streptomycin (100 mg·mL1) with 50 ng·mL1 human macrophage-colony stimulating factor (R&D Systems, Abingdon, Oxon, UK). Medium was changed every 5 days. Cells were used 1014 days after isolation.
Human AMs were obtained from resection tissue from lung cancer patients. Macrophages were flushed from the tissue with PBS. Macrophages were purified by 1 h adhesion to tissue culture plastic in serum-free RPMI. Contaminating cells were removed by stringent washing in RPMI. Cells were incubated for 13 days in RPMI/10% FCS before use in cytokine release experiments.
Real-time quantitative RT-PCR expression studies
RNA was isolated from cell homogenates using Trizol (Invitrogen Ltd) and prepared using RNeasy miniprep column (Qiagen, Crawley, UK) with DNAse. RNA was reverse transcribed with SuperScript II Reverse Transcriptase (Invitrogen Ltd) according to the manufacturer's recommended protocol. Control (-RT) reactions were performed in the absence of reverse transcriptase.
The primers used comprised of the following nucleotides based on published sequences. EP1-Forward: ATGGTGGGCCAGCTTGTC; EP1-Reverse: GCCACCAACACCAGCATTG; EP2-Forward: GCCTGCAACTTCAGTGTCATTC; EP2-Reverse: GTCCGCAGCGGCTTCT; EP3-Forward: GACGGCCATTCAGCTTATGG; EP3-Reverse: CTGATTGAAGATCATTTTCAACATCA; EP4-Forward: ACATGTACGCGGGCTTCAG; EP4-Reverse: GCCGCACACAAGCACGTT. All primers were supplied by Eurogentec Ltd (Southampton, UK). The 18S probe had the following modification: 5'-Yakima Yellow, 3'-Black Hole Quencher 1. RT-PCR was conducted on an Mx3000P RT-PCR machine (Stratagene Europe, Amsterdam, The Netherlands). Samples were run in triplicate for each gene. PCR conditions were: 95°C for 5 min; 50 cycles of 95°C for 20 s followed by 60°C for 90 s; 95°C for 1 min, followed by dissociation curve from 5595°C. Data were collected at the end of each cycle and throughout each dissociation curve. For each gene eight-point, two-fold standard curves were run using a human reference cDNA (Stratagene Europe) as a template. Expression values were calculated from a standard curve and normalised to 18S levels.
Flow cytometry
MDMs and AMs were harvested by scraping, washed in PBS and EP receptor proteins labelled using a BD Pharmingen Cytofix/cytopermTM kit (BD Pharmingen, San Diego, CA, USA) according to the manufacturer's instructions. Rabbit immunoglobulin (Ig)G control was supplied by Sigma-Aldrich, EP2 and EP4 antibodies were supplied by Cayman Chemical and secondary goat anti-rabbit IgG-Alexafluor488 antibody was supplied by Invitrogen Ltd. Primary antibodies were used at 2 µg·mL1 of the final concentration and secondary antibodies at 4 µg·mL1. At each stage 10 µL·mL1 FcR Block (Miltenyi Biotec) was added. Fluorescence was measured using a Beckman Coulter FC500 flow cytometer (Beckman Coulter UK Ltd, High Wycombe, UK).
Cyclic adenosine monophosphate assay
EP4 or EP2 receptor transfected HEK cells were harvested using AccutaseTM (Innovative Cell Technologies Inc., San Diego, CA, USA) and plated at 50,000 cells·well1 in DMEM/10% FCS in poly-D-lysine coated 96-well plates (BD Labware, Bedford, MA, USA). The following day, cells were washed twice and incubated in serum-free DMEM containing IBMX (1 mM). Ono-AE2-227 was added 20 min later for 15 min. PGE2 was then added for a further 20 min. Cyclic adenosine monophosphate (cAMP) in cell lysates was measured using RPN225 cAMP EIA Biotrak system (GE Healthcare Amersham Biosciences, Chalfont St Giles, UK) according to protocol 3 of the manufacturer's instructions.
Cytokine release assay
MDMs and AMs were harvested, washed and plated at 50,000 cells·well1 in a 96-well plate in IMDM containing 0.5% FCS for 12 h. EP agonists were then added as indicated, followed 15 min later by LPS (100 ng·mL1 final concentration). Cells were incubated for 24 h. In experiments using Ono-AE2-227, this agent was added 20 min before PGE2. Where used, indomethacin (10 µM) was added 2 h before the addition of PGE2. Supernatants were harvested and cytokines measured using optEIA ELISA kits (BD Biosciences, Erembodegen, Belgium) according to the manufacturer's instructions.
| DATA ANALYSIS |
|---|
|
|
|---|
|
| (001) |
in which
, [A]50 and nH are the asymptote (maximum effect), location (potency) and slope parameters, respectively. [A]50 values were assumed to be log-normally distributed and quoted as p[A]50 (-log[A]50) values.
In most instances data from individual experiments were fitted to equation 1. However, the AM data were more variable than the MDM data and in this case the mean data were fitted to equation 1.
All cytokine data were expressed as percentage inhibitions of the LPS-induced response. cAMP data were expressed as per cent maximum response to PGE2.
Antagonist affinity estimation
[A]50 data obtained in antagonist experiments were fitted to the following linear form of the Schild equation 20:
|
| (002) |
|
| (003) |
Computer simulation of two-receptor systems
In order to interpret the data from the experiments using Ono-AE2-227 it was necessary to consider the action of a selective antagonist on a one-agonist, two-receptor system. The model of Furchgott 21 was used to simulate the expectations of such an interaction. This model is an extension of the traditional model for a one-receptor system 22, 23, in which pharmacological effect (E) is assumed to be a function of stimulus (S). In the two-receptor case the combined stimulus is imparted by the interaction of the agonist at each receptor, thus:
|
| (004) |
where e1 and e2 are the efficacies of the agonist at each receptor and p1 and p2 are the respective fractional occupancies.
Furchgott 21 assumed that the relationship between S and E can be described by:
|
| (005) |
When a competitive antagonist able to interact with each receptor is present the occupancies p1 and p2 are defined by:
|
| (006) |
|
| (007) |
where KA1, KA2, KB1 and KB2 are the dissociation constants of the agonist and antagonist respectively for the two receptors.
Equations 4, 5 and 6 were used to generate theoretical agonist concentrationeffect curves in the presence and absence of the competitive antagonist in the MDM and AM systems. These simulations were then superimposed on to the experimental data to see how well the latter fitted the model.
All of the data-fitting procedures and simulations were carried out using Microsoft Excel. Results are expressed and plotted as mean±SE. Statistical differences were assessed by the use of a paired t-test or ANOVA as appropriate and considered significant at the level of p<0.05.
| RESULTS |
|---|
|
|
|---|
release from human macrophages by EP-receptor agonists
, granulocyte macrophage-colony stimulating factor and macrophage inflammatory protein-1ß from MDMs (fig. 1
, so this readout was used in all subsequent studies in both MDMs and AMs. PGE2 caused a concentration-dependent inhibition of LPS-induced TNF-
release from both MDMs (fig. 2a
) of 95.9±4.8%. In AMs, the PGE2 E/[A] curve appeared biphasic, precluding logistic curve fitting and suggesting that more than one receptor type may be involved in the response. To further investigate this, the current authors tested the effects of a range of EP receptor agonists. PGE1-OH (EP4 and EP2) 24, 25 and butaprost (an EP2 receptor selective agonist) 4, 25 were active in both systems. In MDMs they produced similar maximum inhibitions of TNF-
as PGE2 (95.7±1.2% (n = 7) and 94.4±4.78% (n = 4), respectively) but were 10-fold and 245-fold less potent than PGE2 (p[A]50 7.51±0.07 (n = 7) and p[A]50 6.12±0.13 (n = 4), respectively). By measuring cAMP elevation in HEK cells transfected with human EP4 it was confirmed that PGE1-OH is a relatively potent EP4 agonist (p[A]50 8.95±0.15; n = 4) and that butaprost is inactive at EP4 up to concentrations of 10 µM (data not shown). In AMs the PGE1-OH and butaprost E/[A] curves were not fully defined at the highest concentrations tested, again precluding logistic curve fitting, but these two agonists were clearly less potent than PGE2. Sulprostone (an EP1/EP3 selective agonist) 4 did not cause significant inhibition in either system at concentrations as high as 10 µM. The activity of butaprost suggested the presence of EP2 receptors in both systems but the relatively high potency of PGE2 and PGE1-OH suggested an additional receptor was involved. Given the inactivity of sulprostone, the most likely candidate was the EP4 receptor.
|
|
|
release from MDMs and AMs. To provide further evidence for this, a reported selective EP4-receptor antagonist, Ono-AE2-227, was synthesised and characterised in HEK cells stably expressing human EP4 or EP2 receptors. In the EP4 system, this compound inhibited PGE2-mediated elevations of cAMP and the resulting curve displacements did not deviate significantly from parallelism (ANOVA; fig. 4a
|
1 µM (fig. 4c
Effect of Ono-AE2-227 on PGE2-induced inhibitions of TNF-
release from MDMs and AMs
In MDMs, Ono-AE2-227 produced parallel right-ward shifts of the PGE2 E/[A] curve, indicating involvement of EP4 receptors in this response, but the interaction was inconsistent with simple competitive behaviour (fig. 5a
; compare with fig. 4a
). This was confirmed by fitting the [A]50 data to equation 2, which yielded a slope value (0.53±0.03 (n = 4)), significantly less than unity (data not shown). A theoretical model was used that describes the behaviour of an agonist in a system in which its response is mediated through two distinct receptor types (see Materials and methods section). Figure 5b
shows the result of this analysis in which the model-generated curves were super-imposed on to the experimental data. The good accordance of the lines with the data points support the hypothesis: Ono-AE2-227 initially shifts the PGE2 control curve by blocking EP4 receptors, but as its concentration is increased the PGE2 curves hit a "resistant phase", which is most likely the result of EP2 receptor activation.
|
|
release in the presence of low concentrations of PGE2 (fig. 6a
|
|
| DISCUSSION |
|---|
|
|
|---|
The present authors' initial pharmacological findings were supported by expression studies in these cells that demonstrated significant expression of EP4 and EP2 receptor mRNA and protein, but barely detectable levels of EP1 and EP3 receptor mRNA (fig. 3
). These data are similar to those reported in other human macrophage systems 27, although Takayama et al. 15 found mRNA for only EP4 in human MDMs. This may be due to the increased sensitivity of the quantitative real-time RT-PCR used in this study over the static end-point RT-PCR method used in the study by Takayama et al. 15.
The EP4 receptor selective antagonist, Ono-AE2-227, produced right-ward shifts of the PGE2 E/[A] curve in MDMs that were parallel but clearly did not accord with simple competition at a homogeneous population of receptors (fig. 5a
). A theoretical model describing the action of an agonist with two distinct receptor populations was able to accommodate the present data set well (fig. 5b
). The finding that low concentrations of Ono-AE2-227 shifted the PGE2 E/[A] curve indicate that EP4 receptors are the dominant receptor type mediating the agonist responses. The PGE2 E/[A] curve obtained in the presence of 1 µM Ono-AE2-227 is likely to represent EP2 activity in MDMs, since >99.9% of the EP4 receptors are occupied by this concentration of antagonist (fig. 4a
).
In the AM system, Ono-AE2-227 clearly potentiated the LPS response in a concentration-dependent manner (fig. 6a
). This suggested that these cells were releasing endogenous PGE2, a phenomenon that has been reported by other investigators 16, 28. The current authors did not observe such an effect in the MDM system suggesting that the activation state of these cells may differ. Addition of indomethacin eliminated this basal effect of Ono-AE2-227 in AMs, confirming that it was the result of endogenous prostanoid release. In the presence of indomethacin, Ono-AE2-227 blocked the responses to PGE2, but the curve shifts did not conform to the behaviour expected of a one-receptor system. The data could again be accommodated by the theoretical one-agonist, two-receptor model, requiring only a small alteration of the model parameters corresponding to a two- and four-fold lower protein expression level of EP4 and EP2 receptors, respectively (compare tables 1
and 2
). The lower maximum inhibitions observed in the AMs are consistent with the lower expression of EP4 and EP2 receptors suggested by the modelling and indicated by the present protein expression studies (figs 3b
3e
). This may be a consequence of partial receptor downregulation 29 induced by the endogenous release of PGE2 from these cells.
The current findings are consistent with previously reported data from human monocytes and rodent macrophages, where E-prostanoid2 and E-prostanoid4 receptors have been demonstrated to mediate the anti-inflammatory effects of prostaglandin E2 11, 12, 30. By extending these studies to human alveolar macrophages the current authors have provided evidence to suggest that E-prostanoid4, E-prostanoid2 or mixed E-prostanoid4/E-prostanoid2 receptor agonists could be useful anti-inflammatory drugs in diseases such as chronic obstructive pulmonary disease and acute respiratory distress syndrome.
| REFERENCES |
|---|
|
|
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |