ERJ
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published online before print October 18, 2006, 10.1183/09031936.00047306
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Permissions
Right arrowRequest Permissions
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Griese, M.
Right arrow Articles by Hartl, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Griese, M.
Right arrow Articles by Hartl, D.
Eur Respir J 2007; 29:240-250
Copyright ©ERS Journals Ltd 2007

{alpha}1-Antitrypsin inhalation reduces airway inflammation in cystic fibrosis patients

M. Griese1, P. Latzin1, M. Kappler1, K. Weckerle1, T. Heinzlmaier1, T. Bernhardt2 and D. Hartl1

1 Lung Research Group, Dr. von Hauner Children's Hospital, Ludwig Maximilians University, Munich, and 2 Bayer Healthcare - Biological Products, Q 30, Leverkusen, Germany.

CORRESPONDENCE: M. Griese, Dr. von Hauner Children's Hospital, Ludwig Maximilians University, Lindwurmstr 4, D-80337 Munich, Germany. Fax: 49 8951607872. E-mail: matthias.griese{at}med.uni-muenchen.de

Keywords: {alpha}1-Antitrypsin, cystic fibrosis, elastase, interleukin-8, neutrophils

Received: April 5, 2006
Accepted October 10, 2006


   ABSTRACT
TOP
 ABSTRACT
MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
The airways of cystic fibrosis (CF) patients are characterised by neutrophils that release high amounts of elastase overwhelming the local antiprotease shield. Inhalation of {alpha}1-antitrypsin (AAT) may restore the protease–antiprotease balance and attenuate airway inflammation in CF airways. The aims of the present study were: 1) to assess the best deposition region for inhaled AAT by two different inhalation strategies; and 2) to examine the effect of 4 weeks of AAT inhalation on lung function, protease–antiprotease balance and airway inflammation in CF patients.

In a prospective, randomised study, 52 CF patients received a daily deposition by inhalation of 25 mg AAT for 4 weeks targeting their peripheral or bronchial compartment. The levels of elastase activity, AAT, pro-inflammatory cytokines, neutrophils, immunoglobulin G fragments and the numbers of Pseudomonas aeruginosa were assessed in induced sputum before and after the inhalation period.

Inhalation of AAT increased AAT levels and decreased the levels of elastase activity, neutrophils, pro-inflammatory cytokines and the numbers of P. aeruginosa. However, it had no effect on lung function. No difference was found between the peripheral and bronchial inhalation mode.

In conclusion, although no effect on lung function was observed, the clear reduction of airway inflammation after {alpha}1-antitrypsin treatment may precede pulmonary structural changes. The {alpha}1-antitrypsin deposition region may play a minor role for {alpha}1-antitrypsin inhalation in cystic fibrosis patients.

The major cause of death in patients with cystic fibrosis (CF) is respiratory insufficiency resulting from chronic bacterial infection and progressive destruction of the lung 1. Due to the genetic defect in CF airway epithelial cells, an excessive inflammatory response characterised by high amounts of interleukin (IL)-8 is present in CF airways. IL-8 attracts neutrophils to the lung, resulting in chronic airway inflammation with excessive release of neutrophil elastase overwhelming the antiprotease shield of the airspaces 2.

Neutrophil elastase is a serine protease with broad substrate specificity, stored as a fully active enzyme together with cathepsin G and proteinase 3 in the azurophilic granules of neutrophils 3. Besides invading microorganisms that are the physiological target of elastase, a surplus of the enzyme damages host compounds and pulmonary structures, including cilia 4, elastin 5, fibronectin 6, surfactant proteins A and D 7, 8, immunoglobulins 9 and cell surface receptors on neutrophils 10, 11 and lymphocytes 12. Such damage results in reduced mucociliary clearance 4 and impaired opsonophagocytosis 11. Furthermore, elastase stimulates the production of pro-inflammatory cytokines as IL-8 13 and leukotriene (LT)B4 14.

In the healthy lung, {alpha}1-antitrypsin (AAT) is present at high concentrations and acts as an antiprotease screen to prevent the deleterious effects of free elastase 15. In CF airways, AAT is complexed 16 and proteolytically inactivated 17, resulting in an imbalance of proteases to antiproteases. To attenuate the deleterious effects of free elastase on pulmonary structure and host defense mechanisms, the inhalation of AAT has been proposed as a therapeutic strategy in CF patients 16, 18.

For effective treatment with inhaled AAT, it is essential that the highest possible fraction of the aerosolised drug reaches the target region within the lungs and that the inhalation is performed within a time period that is convenient for the subject. The first aim of the present study was to compare the peripheral and the bronchial AAT deposition modes. The second aim was to examine whether 4 weeks of AAT inhalation has an effect on the protease–antiprotease balance, the percentage of neutrophils, mRNA and protein levels of pro-inflammatory cytokines, the number of Pseudomonas aeruginosa and the percentage of immunoglobulin (Ig)G fragments in the sputum of CF patients.


   MATERIAL AND METHODS
TOP
 ABSTRACT
 MATERIAL AND METHODS
RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
The present study was performed as a multicentre, randomised, open-label, parallel group trial conducted at the following eight study centres: University of Munich, Munich, Germany (coordinating investigator M. Griese); Dept of Internal Medicine, St. Elisabethen Hospital, Frankfurt, Germany (J. Bargon); Depts of Internal Medicine (C. von Mallinckrodt) and Paediatrics (H-G. Posselt), University of Frankfurt, Frankfurt; Depts of Internal Medicine (J. Hohlfeld) and Paediatrics (M. Ballmann), University of Hannover, Hannover, Germany; Dept of Paediatrics, Medical School, University of Giessen, Giessen, Germany (H. Lindemann); and Dept of Paediatrics, University of Cologne, Cologne, Germany (E. Rietschel). The study was monitored by Acromion GmbH, Frechen, Germany. Documented approval was obtained from appropriate ethics committees for all participating centres prior to study commencement, according to good clinical practice guidelines, local laws, regulations and organisation. Written informed consent was obtained from all subjects before any study procedure took place.

Study population
Inclusion criteria were: the diagnosis of CF by clinical symptoms and positive sweat tests or disease inducing mutations; age ≥8 yrs; forced expiratory volume in one second (FEV1) >25% of predicted value; free elastase activity levels detected in the sputum sample at visit 1 (free elastase activity levels two SDs above the negative blank sample); having tested positive at least three times for P. aeruginosa in the previous 2 yrs and positive testing in induced sputum at visit 1; stable concomitant therapy ≥2 weeks prior to visit 1 and during the study; and written informed consent.

Exclusion criteria were: a history of lung transplant; lung surgery within the previous 2 yrs; being on any thoracic surgery waiting list; severe concomitant disease (serious malignant disease, congestive heart failure New York Heart Association III/IV, cor pulmonale with the need of oxygen therapy); severe liver cirrhosis with ascites, hypersplenism or grade III/IV oesophageal varices; selective IgA deficiency with anti-IgA antibodies; active pulmonary exacerbation within the 4 weeks prior to screening; being a current smoker; being pregnant or breastfeeding; and being a female of child-bearing age without adequate contraception.

Study outline
At the first visit (visit 1), eligible subjects received a random number. Accordingly, each subject received an individually programmed SMART CARD (Inamed Gmbh, Gmünden, Germany) to be used in conjunction with the AKITA® device (Inamed GmbH), which determined the respective inhalation pattern with bronchial or peripheral deposition 19. During the following 2-week run-in period, the subjects inhaled an isotonic saline solution once daily in order to get used to the inhalation pattern. At visit 2, baseline measurements were taken and a 4-week treatment period began where AAT was inhaled. After 2 weeks (visit 3) and 4 weeks (visit 4) all measurements were repeated. The study treatment was added to the regular therapy of the patients. Sputum induction was performed only at the study visits in the hospital, as described in detail hereafter.

Treatment administered
In order to determine the optimal region for AAT deposition, two inhalation modes were programmed in a double-blind fashion on a SMART CARD connected to the inhalation device (AKITA® inhalation device with a Pari LC Plus (Pari, Starnberg, Germany) or an Pari LC Star nebuliser (Pari)). Patients were randomly assigned to either bronchial or peripheral deposition, according to the method described by Brand et al. 19.

Peripheral deposition was achieved by a slow inhalation flow (200 mL·s-1) and an individualised inhalation volume calculated from the individual inspiratory capacity determined by spirometry. Therefore, the following formula inhalation volume was used 19:

2xe(-1.5/inspiratory capacity) + 0.25 (1)

The nebuliser of choice for peripheral deposition was a Pari LC Star, delivering an aerosol with a mass median diameter (MMD) of 3.5 µm.

Bronchial deposition was achieved by a very slow inhalation flow of 100 mL·s-1 and a low inhalation volume of 60% of the individual inspiratory capacity, with a maximum value of 0.5 L. The nebuliser used was a Pari LC Plus, generating an aerosol with an MMD of 5.0 µm. The two nebulisers had an identical outer appearance.

The SMART CARDs were programmed to deposit 25 mg AAT (Prolastin®; Bayer Corporation, Clayton, NA, USA) during the treatment phase. Prolastin® is made from human blood plasma and is primarily monomeric in solution (>99.5%). It consists of purified AAT in a buffer containing 100–210 mM sodium, 60–180 mM chloride and 15–28 mM sodium phosphate. During the run-in phase, an equal amount of the isotonic saline solution instead of AAT was inhaled according to the respective inhalation pattern. The daily inhalations took place in the evening between 18:00 and 23:00 h. The time required for the inhalations was 5–15 min, depending on the lung function of the patient. Treatment compliance (date and time of inhalation, number of breaths and completeness of each breath) was monitored on the SMART CARD.

Induced sputum
Induced sputum was obtained at the study visits in the hospital between 9:00 and 13:00 h, following the AAT inhalation the previous evening. Before sputum was induced, subjects underwent physiotherapy and spirometry, then two puffs of salbutamol were inhaled and 5 mL of a 5.85% sodium chloride solution were nebulised for 15 min with the Pari LC Plus connected to a Pari Master compressor (Pari). A physician was present during sputum induction.

The pooled sputum was divided into three different samples: one for bacteriology (0.5–1 mL), one for AAT, elastase, cytokine and neutrophil assessments (3 mL) and one for IgG determination (3 mL). The samples for bacteriological analysis were shipped overnight at 4°C to the Max von Pettenkofer Institute, a south German reference laboratory for P. aeruginosa at the University of Munich, Munich. The samples for AAT, elastase, cytokines, neutrophil and IgG analysis were incubated 1:1 with dithiothreitol (DTT; Sputolysin; Calbiochem Biosciences, Beeston, UK), filtered through Nitex gaze-filters (BD Biosciences, San Diego, CA, USA) and washed with Hanks solution. The sputum suspension was centrifuged at 500xg for 10 min at 4°C and the supernatant was centrifuged at 4,000xg for 20 min at 4°C. The supernatant was then mixed with a protease inhibitor (0.5 mM EDTA, 500 µM Pefabloc (Merck, Darmstadt, Germany), 5 µM E-64, 50 µM Bestatin (both Roche, Basel, Switzerland)) in order to block free elastase activity and to avoid in vitro proteolysis. Aliquots of the supernatant were frozen at -70°C until final analysis. Cytospin slides were prepared with the cell pellet using 200,000 cells per slide. In total, ≥400 cells were differentiated by May-Grünwald-Giemsa staining. The viability was assessed by the trypan blue dye exclusion test. The remaining cells were suspended in Hanks buffer at 4°C and were immediately processed for flow cytometry.

The levels of AAT were measured by ELISA. The levels of free elastase activity were analysed by a chromogenic assay according to standard protocols as described by Hilliard et al. 20. Numbers of P. aeruginosa were quantified according to the method described by Hogardt et al. 21.

Flow cytometry
CD45-allophycocyanin (APC) mouse IgG1 (Pharmingen, Heidelberg, Germany) and mouse IgG1-APC (Immunotech, Marseille, France) as isotype control were used. Calculations were performed with Cell Quest analysis software (Cell Quest Pro; Becton-Dickinson, Heidelberg, Germany). Re-suspended sputum cells were blocked with human IgG for 20 min to avoid nonspecific binding. They were then incubated with monoclonal antibodies for 40 min, washed twice and finally analysed by flow cytometry (FACS Calibur; Becton-Dickinson) as previously described elsewhere 22. Prior to the study, the discrimination between neutrophils and alveolar macrophages was optimised. Gating of neutrophils was based on light scatter properties and positive expression for CD45. In the present experimental setting, macrophages were less of a disturbance than the considerable amount of apoptotic or dead cells present in the sputum of CF patients. Therefore, propidium iodide (5 µg·mL-1; Sigma, St Louis, MO, USA) and Annexin V-fluorescein isothiocyanate (5 µg·mL-1, dilution 1/100; Boehringer Mannheim GmbH, Mannheim, Germany) were used to discriminate intact viable leukocytes (Annexin V-, PI-) from apoptotic (Annexin V+, PI-) and necrotic (Annexin V+, PI+) cells. Only viable neutrophils were included in the analysis. These gates were used to analyse 10,000 neutrophils per sample.

Immunoglobulin G
For the assessment of IgG fragments, a modified method according to Fick et al. 23 was used. A total of 10 µL of the sputum supernatant pre-treated with a proteinase inhibitor were lyophilised, dissolved in 20 µL of sample buffer and reduced for 10 min at 70°C (NuPAGE Reducing Agent; Invitrogen, Madison, WI, USA). The sample, together with 500 µL of antioxidant (NuPAGE antioxidant; Invitrogen), was subjected to electrophoresis (10% Bis-Tris Gel) and 500 ng human IgG was used as standard. The effect of human leukocyte elastase (HLE) on IgG was assessed in vitro by incubation of 500 ng IgG isolated from human serum (Sigma) with HLE (40 U·mL-1; EPC, St. Louis, MO, USA) for 2 h at 37°C. The proteins were transferred on nitrocellulose membranes (Amersham Pharmacia Biotech, Uppsala, Sweden) for semi-dry Western blotting (Xcell II blot). IgG fragments were identified by incubation for 12 h with 2.5 µL of a specific goat anti-human IgG antibody. After intensification of the signal by chemiluminescence, the blots were scanned with a computing densitometer (Fluor-S MultiImager; BioRad, Richmond, CA, USA) and were semi-quantitatively analysed using Quantity One (BioRad). In order to detect corresponding protein spots between gels, all blots were stacked and spots were matched according to their molecular weight.

Cytokine protein levels
Levels of IL-8, tumour necrosis factor (TNF)-{alpha} and IL-1ß were analysed in sputum supernatant in duplicate by a sandwich ELISA according to the manufacturer's instructions (R&D Systems, Minneapolis, MN, USA). The levels of LTB4 were measured in sputum supernatant by a sandwich ELISA according to the manufacturer's instructions (Amersham Pharmacia Biotech). The detection limits were 3.5 pg·mL-1 for IL-8, 0.12 pg·mL-1 for TNF-{alpha}, 1 pg·mL-1 for IL-1ß and 1.25 pg·mL-1 for LTB4. Furthermore, cytokine levels in sputum were analysed with and without DTT pre-treatment at the same dilution used for sputum samples.

Cytokine mRNA levels
mRNA levels of IL-8, TNF-{alpha} and IL-1ß were analysed in induced sputum cell pellets in duplicate by a quantitative real-time RT-PCR system (Icycler; Biorad, Hercules, CA, USA) according to the manufacturer's instructions. The following forward (F) and reverse (R) primer pairs were used. IL-8F: TCTTGGCAGCCTTCCTGATT; IL-8R: TCCAGACAGAGCTCTCTTCCATC; TNF-{alpha}F: AGGAACAGCACAGGCCTTAGTG; TNF-{alpha}R: AAGACCCCTCCCAGATAGATGG; IL-1ßF: CAGGGACAGGATATGGAGCAA; and IL-1ßR: ATGTACCAGTTGGGGAACTG. Induced sputum cells were lysed in Trizol LS Reagent (Invitrogen, Karlsruhe, Germany). Total RNA (200–500 ng) was isolated according to the manufacturer's instructions and reverse transcribed into cDNA. Expression levels of cytokines were determined in duplicate by real-time RT-PCR using SYBR green and the iCycler iQ detection system (Biorad). Threshold cycle values for genes of interest were normalised to glyceraldehyde-3-phosphate dehydrogenase and used to calculate the relative quantity of mRNA expression.

Statistics
The primary analysis population was a modified intention-to-treat (mITT) population, including all randomised subjects who received any amount of study medication (AAT) and had at least one evaluation of the primary efficacy variable, i.e. free elastase activity in induced sputum at baseline (visit 2). The primary efficacy comparison for the change in free elastase activity in induced sputum from baseline to end-point was a two-way ANCOVA with treatment group and centre as fixed factors (main effect model) and baseline measurement of free elastase activity in induced sputum as covariate in the mITT population. Based on the SD of elastase activity levels in sputum as previously described elsewhere 3, 24, a sample size of 24 subjects per treatment group was calculated to detect a change in free elastase activity in induced sputum in the magnitude of the SD at a 5% two-sided alpha and a power of 80%. All further calculations were made in an exploratory way, including the evaluation of the overall treatment effect as pre- and post-comparisons for the combined deposition groups (Wilcoxon and sign test with Bonferroni correction for multiple comparisons).


   RESULTS
TOP
 ABSTRACT
 MATERIAL AND METHODS
 RESULTS
DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 
Study population, deposition modes and safety
In total, 72 CF subjects were enrolled in the present study. A total of 37 subjects were randomised to the group for peripheral deposition and 35 to the group for bronchial deposition (fig. 1Go). Eight subjects dropped out during the run-in phase prior to AAT treatment due to the following protocol violations: inability to produce sputum (two patients), diagnosis of IgA deficiency after inclusion into the study (one patient), inability to perform daily inhalations with the AKITA® device due to personal breathing pattern (one patient) and withdrawal of consent or cessation of the study for personal reasons (four subjects). Another five patients incurred other protocol violations that excluded them from the study. Therefore, 59 subjects received at least one dose of study drug and were valid for safety and intention-to-treat (ITT) analysis. Seven subjects were excluded due to missing or invalid data for the primary efficacy variable (free elastase activity in induced sputum), because no sputum was produced or the sputum was unavailable for analysis. The group of subjects remaining (mITT group) was defined before the study as the primary analysis population. Thus, the analysis was based on 28 subjects using inhalation for peripheral deposition and 24 subjects using inhalation for bronchial deposition. The baseline characteristics were not statistically different between the two deposition groups (table 1Go). Electronically recorded compliance with the study drugs was good.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

  		Fig. 1— The figure shows the algorithm of the patient selection. CF: cystic fibrosis; ITT: intention-to-treat; mITT: modified ITT.

 

View this table:
[in this window]
[in a new window]

  		Table 1— Patient characteristics and compliance of the primary analysis population(modified intention-to-treat population)

 
The number of subjects with adverse events was 10 out of 30 (seven out of 28 in the treatment phase) in the peripheral deposition group and 13 out of 29 (eight out of 24 in the treatment phase) in the bronchial deposition group. With the exception of one severe adverse event (sinusitis), all other events were of mild or moderate intensity. No serious adverse events occurred. All adverse events had resolved or improved by the end of the study. Three subjects in each group experienced drug-related adverse events. One of these (fatigue) was attributable to the inhalation manoeuvre or the saline, as it had already occurred during the run-in phase. Two other drug-related adverse events (fatigue and haemoptysis) arose in the bronchial deposition group and three in the peripheral deposition group (pruritus, influenza-like illness, gastro-intestinal pain).

No significant differences between the peripheral and bronchial deposition group were noted at baseline or after 2 and 4 weeks of AAT inhalation with respect to free elastase activity, AAT level, the percentage of neutrophils, P. aeruginosa counts, cytokine levels, IgG fragments in sputum (table 2Go), lung function (FEV1, functional vital capacity, maximum expiratory flow at 25% of vital capacity), number of exacerbations and overall rate of adverse effects (data not shown). As no difference between peripheral or bronchial AAT deposition site was found for any of the parameters analysed, the overall effect of inhaled AAT was assessed in an explorative analysis by combining the two deposition groups and making before and after comparisons.


View this table:
[in this window]
[in a new window]

  		Table 2— Variables measured in the peripheral and bronchial deposition group and their changes from baseline to end-point after 4 weeks of {alpha}1-antitrypsin (AAT) inhalation

 
{alpha}1-Antitrypsin and free elastase activity
Treatment with 25 mg of AAT increased the concentration of AAT after 2 (p<0.001) and 4 weeks of treatment (p<0.001; fig. 2aGo) and slightly reduced the levels of free elastase activity in induced sputum after 4 weeks of treatment (p<0.05; fig. 2bGo). Furthermore, the AAT inhalation decreased percentages of sputum neutrophils after 4 weeks of treatment (p<0.05; fig. 3aGo) and reduced P. aeruginosa counts after 4 weeks of treatment (p<0.05; fig. 3bGo), while FEV1 did not change (fig. 3cGo).


Figure 2
View larger version (10K):
[in this window]
[in a new window]

  		Fig. 2— Levels of {alpha}1-antitrypsin (AAT) and free elastase activity. a) Sputum levels of AAT and b) free elastase activity levels at the end of the run-in period (baseline) and after 2 and 4 weeks of AAT inhalation. p-Values are shown as comparisons to baseline (sign test and corrected by Bonferroni). Bars represent mean values+SEM. NS: nonsignificant. ***: p<0.001; *: p<0.05.

 

Figure 3
View larger version (8K):
[in this window]
[in a new window]

  		Fig. 3— Neutrophils, Pseudomonas aeruginosa and lung function. a) Percentages of neutrophils, b) P. aeruginosa counts in induced sputum and c) forced expiratory volume in one second (FEV1) at the end of the run-in period (baseline) and after 2 and 4 weeks of {alpha}1-antitrypsin inhalation. cfu: Colony-forming unit. p-Values are shown as comparisons to baseline (sign test and corrected by Bonferroni). Bars represent mean values+SEM. NS: nonsignificant; % pred: % predicted. *: p<0.05.

 
In conclusion, these data suggest that 4 weeks of {alpha}1-antitrypsin inhalation reduce airway inflammation in cystic fibrosis patients. Although no effect on lung function was observed, reduced airway inflammation may precede pulmonary structural changes. Longer, placebo-controlled studies aiming to deposit optimal amounts of {alpha}1-antitrypsin into the lungs of cystic fibrosis patients are worthwhile undertaking.

Pro-inflammatory cytokines
DTT treatment had no significant effect on IL-8, TNF-{alpha}, IL-1ß or LTB4 levels (data not shown). Sputum protein levels of IL-8 (fig. 4aGo), IL-1ß (fig. 4bGo), TNF-{alpha} (fig. 4cGo) and LTB4 (fig. 4dGo) and sputum mRNA levels of IL-8 (fig. 5aGo), IL-1ß (fig. 5bGo) and TNF-{alpha} (fig. 5cGo) decreased significantly after 2 and 4 weeks of AAT inhalation when compared with the baseline. The changes of IL-8 (r = 0.48, p<0.01), IL-1ß (r = 0.39, p<0.05), TNF-{alpha} (r = 0.4, p<0.05) and LTB4 (r = 0.45, p<0.05) protein levels and the changes of neutrophils (r = 0.52, p<0.01) correlated positively with the changes of free elastase levels.


Figure 4
View larger version (11K):
[in this window]
[in a new window]

  		Fig. 4— Pro-inflammatory cytokines. Protein levels of a) interleukin (IL)-8, b) IL-1ß, c) tumour necrosis factor-{alpha} and d) leukotriene B4 in sputum supernatant at the end of the run-in period (baseline) and after 2 and 4 weeks of {alpha}1-antitrypsin inhalation. *: p<0.05; **: p<0.01.

 

Figure 5
View larger version (9K):
[in this window]
[in a new window]

  		Fig. 5— Pro-inflammatory cytokines. mRNA levels of a) interleukin (IL)-8, b) IL-1ß and c) tumour necrosis factor-{alpha} in sputum cell pellets at the end of the run-in period (baseline) and after 2 and 4 weeks of {alpha}1-antitrypsin inhalation. Threshold cycle values for genes of interest were normalised to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and used to calculate the relative quantity of mRNA expression. p-Values are shown as comparisons to baseline (sign test and corrected by Bonferroni). Bars represent mean values+SEM. *: p<0.05; **: p<0.01.

 
Immunoglobulin G
CF-related proteases were found to cleave IgG into two antigen-binding fragments (F(ab)2) and crystallisable fragments (Fc) 23, 25, 26. In sputum samples of the CF patients in the present study, IgG bands of 26 kDa, 32 kDa, 36 kDa, 43 kDa and 54 kDa were detected under reducing conditions (fig. 6Go). In accordance with previous studies analysing proteolytically cleaved IgG fragments 3, 23, 27–29, the 26-kDa band corresponded to the reduced form of the IgG light chain, the 32-kDa band to the cleaved IgG Fc fragment 27, 28 and the 43-kDa band to the cleaved F(ab)2 fragment 28. The 36-kDa band could not be identified. The 54-kDa band represented the reduced form of the regular IgG heavy chain of 168 kDa 27–29. The treatment of IgG with HLE cleaved IgG into F(ab)2 and Fc fragments. The percentages of 54-kDa IgG increased significantly after 4 weeks of AAT inhalation (fig. 7aGo), whereas no significant change was found for the other IgG bands. The percentages of 54-kDa IgG correlated inversely with levels of free elastase activity in sputum before and after AAT treatment (fig. 7bGo).


Figure 6
View larger version (21K):
[in this window]
[in a new window]

  		Fig. 6— Immunoglobulin (Ig)G in sputum of cystic fibrosis (CF) patients. Reduced IgG fragments in sputum of a representative CF patient before (lane 1) and after (lane 2) 4 weeks of {alpha}1-antitrypsin inhalation compared to 500 ng of human IgG (lane 3) and 500 ng human IgG treated in vitro with 40 U of human leukocyte elastase (HLE) for 2 h at 37°C (lane 4). The treatment of IgG with HLE cleaved IgG into two antigen-binding (F(ab)2) and crystallisable (Fc) fragments.

 

Figure 7
View larger version (11K):
[in this window]
[in a new window]

  		Fig. 7— Immunoglobulin (Ig)G 54-kDa fragments and free elastase activity levels. a) Percentages of 54-kDa IgG in induced sputum of cystic fibrosis (CF) patients at the end of the run-in period (baseline) and after 2 and 4 weeks of inhalation of 25 mg of {alpha}1-antitrypsin (AAT) once daily. Bars represent mean values+SEM. p-Values are shown as comparisons to baseline (sign test and corrected by Bonferroni). NS: nonsignificant. **: p<0.01. b) Correlation between percentages of 54-kDa IgG and free elastase activity levels in induced sputum of CF patients at the end of the run-in period ({circ}; r = -0.49, p<0.05) and after 4 weeks of AAT inhalation (•; r = -0.43, p<0.05). 54-kDa IgG is expressed as a percentage of the total IgG detected. Correlations were calculated using Spearman rho test.

 

   DISCUSSION
TOP
 ABSTRACT
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
ACKNOWLEDGEMENTS
 REFERENCES
 
For effective treatment with inhaled AAT it is essential that the highest possible fraction of the aerosolised drug reaches the target region within the lung. In previous studies, the aerosol and breathing characteristics that allow a preferential targeting of inhaled drugs to specific regions within the lungs of CF patients had been defined 19, 30. To the present authors’ knowledge, this is the first study examining possible differences in medication efficacy between the peripheral and bronchial deposition site in the lungs of CF patients. A known and fixed amount of AAT was deposited into the airways of each patient, exactly controlled by the AKITA® device. It is hypothesised that a more peripheral AAT deposition might be superior to a bronchial deposition. However, no significant difference was found between the two deposition modes with regard to the changes in free elastase activity levels and several other parameters.

Despite the minor changes in free elastase activity levels after AAT treatment, the inhalation of AAT significantly decreased airway inflammation, as assessed by the analysis of neutrophils and pro-inflammatory cytokines in induced sputum. Recent studies suggest a role for AAT as an anti-inflammatory modulator 31 independent of its antiprotease effect. AAT inhibited lipopolysaccharide (LPS)-induced TNF-{alpha} and IL-1ß release from monocytes dose-dependently and IL-8 release from neutrophils in vitro. Furthermore, AAT instillation after LPS challenge prevented LPS-induced IL-8 production in vivo 31. Sputum protein and mRNA levels of IL-1ß and TNF-{alpha} decreased significantly after AAT inhalation in the present CF patients. Therefore, it is speculated that the AAT inhalation may inhibit the LPS-induced production of TNF-{alpha} and IL-1ß by epithelial cells and alveolar macrophages 32, thereby attenuating pulmonary inflammation in CF patients. The inhibition of other serine proteases that are also neutralised by AAT inhalation, such as proteinase 3, may contribute to the discrepancy between the small effects of AAT inhalation on elastase activity levels and the clear effects found on inflammatory parameters.

The finding that 4 weeks of AAT inhalation decreased neutrophilic inflammation in CF airways is in line with a rat model of chronic P. aeruginosa lung infection 33, where aerosolised AAT decreased pulmonary neutrophils and numbers of bacteria 33. In a study by McElvaney et al. 34, the inhalation of aerosolised AAT in patients with CF increased AAT levels and decreased elastase activity levels in bronchoalveolar lavage (BAL) fluid. In contrast to the study of McElvaney et al. 34, the inhalation of AAT in the patients of the present study did not decrease elastase activity levels substantially. This discrepancy might be due to the material used, i.e. BAL versus induced sputum. Compared with BAL supernatant, where mucus and debris are removed by filtration, induced sputum is a more complex matrix that contains numerous broken and necrotic neutrophils, including high amounts of neutrophil elastase. Therefore, all sputum samples in the present study were obtained by defined induction techniques, shipped to a central laboratory and analysed under standardised conditions. Nevertheless, the ex vivo manipulation of induced sputum samples, i.e. mixing and centrifugation, probably leads to the release of intracellular elastase into the sputum supernatant. Thus, it is speculated that the neutralisation of all proteases present in the sputum sample ex vivo requires more antiproteases than those dissolved in BAL fluid supernatant. At first glance, it may therefore be preferable to use BAL for the assessment of antiprotease treatment effects in CF patients. However in CF patients, elastase and neutrophils are more abundant in sputum compared with BAL 35, 36. Furthermore, it must be kept in mind that BAL reflects also the alveolar compartment and CF lung disease is primarily confined to the bronchial and bronchiolar compartment.

Martin et al. 37 examined the effect of inhaled recombinant AAT derived from sheep in CF patients and used spontaneous expectorated sputum for the analysis of free elastase, AAT, myeloperoxidase and IL-8 levels. Despite the higher doses of AAT used and in agreement with the present authors’ observations, the AAT inhalation was unable to completely neutralise free elastase in sputum. The deposition mode and compliance were not controlled. In line with the present findings, the levels of myeloperoxidase, a marker for neutrophils, were lower in the sputum of the CF patients after the AAT treatment period. Percentages of neutrophils and P. aeruginosa counts were not analysed.

CF proteases are known to cleave IgG into F(ab)2 and Fc fragments resulting in a deficiency of intact IgG proteins and an accumulation of functionally impaired IgG cleavage fragments 3, 23. These IgG fragments influence the function of neutrophils in vitro by an impairment of bacteria-induced chemotaxis 28, oxidative burst 27 and enzyme release 29, leading to defective opsonophagocytosis 23. In the present study, high elastase activity levels in sputum were associated with decreased intact (54 kDa) IgG proteins and the inhalation of AAT was associated with increased intact IgG proteins in CF airways. Similarly, Fick et al. 23 found an inverse association between intact IgG proteins and free elastase activity in BAL of CF patients. Cleaved IgG fragments (12–43 kDa) in sputum of the present CF patients remained unchanged after AAT treatment. The removal of degraded IgG fragments by alveolar phagocytes may account for this observation.

The present study has several limitations. Since the primary goal was to assess the differences between the efficacies of the two deposition modes, no placebo control group was included, which substantially limits the conclusions that can be drawn from the data. For future studies examining the effect of AAT inhalation in CF patients, a placebo control group is indispensable. Although very consistent and fitting the current concept of proteolytic airway injury, particular effects of AAT inhalation observed in the current study might be nonspecific.

The two breathing patterns chosen to obtain a more peripheral or central deposition still had an estimated overlap of 30%. Thus, with both breathing patterns, the deposition of a substantial fraction of the inhaled drug in the small airways could not be avoided. Thus, it cannot be completely excluded that the lack of difference in the AAT treatment effect between both breathing patterns may be due to AAT deposition in the small airways in both cases.

Furthermore, the sample size calculation performed prior to the study commencement was based on previous observations by Döring and co-workers 3, 24 but the elastase activity levels and elastase changes found in the present study were markedly lower. Based on the present mean±SD values for free elastase activity in sputum, a new study intended to detect a drop in free elastase activity from 30 µg·mL-1 to 15 µg·mL-1 with a power of 80% would require ~60 CF subjects per group. Free elastase activity was still detectable in sputum after 4 weeks of AAT treatment. A lack of adherence to the inhalation could be excluded since electronically monitored compliance was found to be good. Since it is technically feasible to deliver several-fold larger doses of AAT within an adequate inhalation time, AAT amounts >25 mg deposited in the lungs may be reasonable.

Figure 8Go summarises the effects of free elastase in the airways of CF patients. Physiologically, elastase is complexed and neutralised by AAT. Due to the elastase/AAT imbalance in CF airways, free elastase activity damages the pulmonary environment in several ways. Elastase impairs the innate immune response by cleaving the complement receptor 1 on neutrophils and the phosphatidylserine receptor on macrophages (not shown), thereby decreasing bacterial killing and clearance of apoptotic cells. Elastase triggers the production of IL-8 by bronchial epithelial cells 13. The released IL-8, in turn, induces elastase secretion by neutrophils and attracts neutrophils to the lung. Elastase impairs the adaptive immunity by cleaving IgG into F(ab)2 and Fc fragments 23. The impaired pulmonary host defense leads to increased numbers of bacteria in CF airways. Finally, chronic proteolytic damage of pulmonary structures leads to bronchiectasis and lung destruction in CF patients.


Figure 8
View larger version (25K):
[in this window]
[in a new window]

  		Fig. 8— Effects of elastase in cystic fibrosis (CF) airways. Upon stimulation with interleukin (IL)-8, human leukocyte elastase (HLE) is released by neutrophils into the airways (1) where HLE is complexed and neutralised by {alpha}1-antitrypsin (AAT; 2). Due to a HLE/AAT imbalance in CF airways, free HLE damages the pulmonary environment in several ways (3–8). HLE impairs the innate immune response by cleaving the complement receptor 1 (CR1) on neutrophils (3), thereby reducing bacterial killing. In addition, HLE triggers the IL-8 production by bronchial epithelial cells (4). The released IL-8 attracts large numbers of neutrophils from the circulation through endothelial cells to the alveolar space (5). HLE impairs the adaptive immunity by cleaving immunoglobulin G into F(ab)2 and Fc fragments (6). The impaired host defence leads to increased numbers of bacteria harming the lung tissue (7). Finally, multiple proteolytic damage of pulmonary structures leads to bronchiectasis and lung destruction in CF patients (8). Exogenous supplementation with AAT may attenuate these deleterious processes. Furthermore, AAT may act as an anti-inflammatory, independently of its antiprotease activity, by reducing free IL-8 levels in CF airways (9).

 


   ACKNOWLEDGEMENTS
TOP
 ABSTRACT
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
REFERENCES
 
For the {alpha}1-antitrypsin study group the authors would like to thank: J. Bargon, Dept of Internal Medicine, St. Elisabethen-Hospital, Frankfurt, Germany; C. von Mallinckrodt, Dept of Internal Medicine and H.G. Posselt, Dept of Paediatrics, University of Frankfurt, Frankfurt; J. Hohlfeld, Dept of Internal Medicine and M. Ballmann, Dept of Paediatrics, University of Hannover, Hannover, Germany; H. Lindemann, Dept of Paediatrics, University of Giessen, Giesen, Germany; and E. Rietschel, Dept of Paediatrics, University of Cologne, Cologne, Germany. The authors would also like to thank J. Humphries for skilled advice in study design and B. Sommerauer for biometric analysis. Thanks also go to B. Müllinger, G. Scheuch (Inamed, Gmünden, Germany), S. Gruschka and A. Schams (University Childrens' Hospital, Munich, Germany) for excellent technical assistance.


   FOOTNOTES
 
For editorial comments see page 229. Back


   REFERENCES
TOP
 ABSTRACT
 MATERIAL AND METHODS
 RESULTS
 DISCUSSION
 ACKNOWLEDGEMENTS
 REFERENCES
 

  1. Davis PB, Drumm M, Konstan MW. Cystic fibrosis. Am J Respir Crit Care Med 1996;154:1229–1256.[Web of Science][Medline] [Order article via Infotrieve]
  2. Konstan MW, Berger M. Current understanding of the inflammatory process in cystic fibrosis: onset and etiology. Pediatr Pulmonol 1997;24:137–142.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  3. Döring G, Goldstein W, Botzenhart K, et al. Elastase from polymorphonuclear leucocytes: a regulatory enzyme in immune complex disease. Clin Exp Immunol 1986;64:597–605.[Web of Science][Medline] [Order article via Infotrieve]
  4. Amitani R, Wilson R, Rutman A, et al. Effects of human neutrophil elastase and Pseudomonas aeruginosa proteinases on human respiratory epithelium. Am J Respir Cell Mol Biol 1991;4:26–32.[Web of Science][Medline] [Order article via Infotrieve]
  5. Kimbel P. Proteolytic lung damage. Chest 1980;77:274–276.
  6. Suter S, Schaad UB, Morgenthaler JJ, Chevallier I, Schnebli HP. Fibronectin-cleaving activity in bronchial secretions of patients with cystic fibrosis. J Infect Dis 1988;158:89–100.[Web of Science][Medline] [Order article via Infotrieve]
  7. Griese M, Wiesener A, Lottspeich F, von Bredow C. Limited proteolysis of surfactant protein D causes a loss of its calcium-dependent lectin functions. Biochim Biophys Acta 2003;1638:157–163.[Medline] [Order article via Infotrieve]
  8. von Bredow C, Wiesener A, Griese M. Proteolysis of surfactant protein D by cystic fibrosis relevant proteases. Lung 2003;181:79–88.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  9. Fick RB Jr, Baltimore RS, Squier SU, Reynolds HY. IgG proteolytic activity of Pseudomonas aeruginosa in cystic fibrosis. J Infect Dis 1985;151:589–598.[Web of Science][Medline] [Order article via Infotrieve]
  10. Berger M, Dearborn D, Legris G, Döring G, Sorensen R. Complement receptor expression on neutrophils (PMN) in the lung in cystic-fibrosis (CF). Pediatr Res 1986;20:A305
  11. Berger M, Sorensen RU, Tosi MF, Dearborn DG, Döring G. Complement receptor expression on neutrophils at an inflammatory site, the pseudomonas-infected lung in cystic fibrosis. J Clin Invest 1989;84:1302–1313.[Web of Science][Medline] [Order article via Infotrieve]
  12. Döring G, Frank F, Boudier C, Herbert S, Fleischer B, Bellon G. Cleavage of lymphocyte surface antigens CD2, CD4, and CD8 by polymorphonuclear leukocyte elastase and cathepsin G in patients with cystic fibrosis. J Immunol 1995;154:4842–4850.[Abstract]
  13. Nakamura H, Yoshimura K, McElvaney NG, Crystal RG. Neutrophil elastase in respiratory epithelial lining fluid of individuals with cystic fibrosis induces interleukin-8 gene expression in a human bronchial epithelial cell line. J Clin Invest 1992;89:1478–1484.[Web of Science][Medline] [Order article via Infotrieve]
  14. Hubbard RC, Fells G, Gadek J, Pacholok S, Humes J, Crystal RG. Neutrophil accumulation in the lung in apha-1-antitrypsin deficiency. Spontaneous release of leukotriene B4 by alveolar macrophages. J Clin Invest 1991;88:891–897.[Web of Science][Medline] [Order article via Infotrieve]
  15. Birrer P. Proteases and antiproteases in cystic fibrosis: pathogenetic considerations and therapeutic strategies. Respiration 1995;62: Suppl. 1 25S–28S.
  16. Birrer P, McElvaney NG, Rudeberg A, et al. Protease-antiprotease imbalance in the lungs of children with cystic fibrosis. Am J Respir Crit Care Med 1994;150:207–213.[Abstract]
  17. Suter S, Chevallier I. Proteolytic inactivation of alpha 1-proteinase inhibitor in infected bronchial secretions from patients with cystic fibrosis. Eur Respir J 1991;4:40–49.[Abstract]
  18. Allen ED. Opportunities for the use of aerosolized alpha 1-antitrypsin for the treatment of cystic fibrosis. Chest 1996;110: Suppl. 6 256S–260S.
  19. Brand P, Meyer T, Haussermann S, et al. Optimum peripheral drug deposition in patients with cystic fibrosis. J Aerosol Med 2005;18:45–54.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  20. Hilliard J, Konstan MW, Davis PB. Inflammatory mediators in CF patients. Methods Mol Med 2002;70:409–431.[Medline] [Order article via Infotrieve]
  21. Hogardt M, Trebesius K, Geiger AM, Hornef M, Rosenecker J, Heesemann J. Specific and rapid detection by fluorescent in situ hybridization of bacteria in clinical samples obtained from cystic fibrosis patients. J Clin Microbiol 2000;38:818–825.[Abstract/Free Full Text]
  22. Alexis N, Soukup J, Ghio A, Becker S. Sputum phagocytes from healthy individuals are functional and activated: a flow cytometric comparison with cells in bronchoalveolar lavage and peripheral blood. Clinical Immunology 2000;97:21–32.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  23. Fick RB Jr, Naegel GP, Squier SU, Wood RE, Gee JB, Reynolds HY. Proteins of the cystic fibrosis respiratory tract. Fragmented immunoglobulin G opsonic antibody causing defective opsonophagocytosis. J Clin Invest 1984;74:236–248.[Web of Science][Medline] [Order article via Infotrieve]
  24. Döring G. The role of neutrophil elastase in chronic inflammation. Am J Respir Crit Care Med 1994;150:114–117.
  25. Bainbridge T, Fick RB Jr. Functional importance of cystic fibrosis immunoglobulin G fragments generated by Pseudomonas aeruginosa elastase. J Lab Clin Med 1989;114:728–733.[Web of Science][Medline] [Order article via Infotrieve]
  26. Kolb G, Eckle I, Heidtmann HH, Neurath F, Havemann K. Neoantigenic group on Fc fragments in rheumatoid arthritis synovial fluids. Scand J Rheumatol Suppl 1988;75:179–189.[Medline] [Order article via Infotrieve]
  27. Eckle I, Kolb G, Havemann K. Inhibition of neutrophil oxidative burst by elastase-generated IgG fragments. Biol Chem Hoppe Seyler 1990;371:69–77.[Web of Science][Medline] [Order article via Infotrieve]
  28. Eckle I, Kolb G, Havemann K. Inhibition of neutrophil chemotaxis by elastase-generated IgG fragments. Scand J Immunol 1991;34:359–364.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  29. Eckle I, Kolb G, Havemann K. Regulation of neutrophil functions by elastase-generated IgG fragments. Arch Immunol Ther Exp (Warsz) 1992;40:43–47.[Medline] [Order article via Infotrieve]
  30. Brand P, Beckmann H, Maas EM, et al. Peripheral deposition of alpha1-protease inhibitor using commercial inhalation devices. Eur Respir J 2003;22:263–267.[Abstract/Free Full Text]
  31. Nita I, Hollander C, Westin U, Janciauskiene SM. Prolastin, a pharmaceutical preparation of purified human alpha1-antitrypsin, blocks endotoxin-mediated cytokine release. Respir Res 2005;6:12[CrossRef][Medline] [Order article via Infotrieve]
  32. Bonfield TL, Konstan MW, Berger M. Altered respiratory epithelial cell cytokine production in cystic fibrosis. J Allergy Clin Immunol 1999;104:72–78.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  33. Cantin A, Woods DE. Aerolized prolastin suppresses bacterial proliferation in a model of chronic Pseudomonas aeruginosa lung infection. Am J Respir Crit Care Med 1999;160:1130–1135.[Abstract/Free Full Text]
  34. McElvaney NG, Hubbard RC, Birrer P, et al. Aerosol alpha 1-antitrypsin treatment for cystic fibrosis. Lancet 1991;337:392–394.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]
  35. Ratjen F, Rietschel E, Griese M, et al. Fractional analysis of bronchoalveolar lavage fluid cytology in cystic fibrosis patients with normal lung function. Bronchoalveolar lavage for the evaluation of anti-inflammatory treatment (BEAT) study group. Eur Respir J 2000;15:141–145.[Abstract]
  36. Reinhardt N, Chen CI, Loppow D, et al. Cellular profiles of induced sputum in children with stable cystic fibrosis: comparison with BAL. Eur Respir J 2003;22:497–502.[Abstract/Free Full Text]
  37. Martin SL, Downey D, Bilton D, Keogan MT, Edgar J, Elborn JS. Safety and efficacy of recombinant alpha(1)-antitrypsin therapy in cystic fibrosis. Pediatr Pulmonol 2006;41:177–183.[CrossRef][Web of Science][Medline] [Order article via Infotrieve]



This article has been cited by other articles:


Home page
 ChestHome page
A. Wanner
COPD: New Lessons From {alpha}1-Antitrypsin Deficiency?
Chest, May 1, 2009; 135(5): 1342 - 1344.
[Full Text] [PDF]

Home page
 ThoraxHome page
D G Downey, S C Bell, and J S Elborn
Neutrophils in cystic fibrosis
Thorax, January 1, 2009; 64(1): 81 - 88.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
S. Janciauskiene, I. Nita, D. Subramaniyam, Q. Li, J. R. Lancaster Jr., and S. Matalon
{alpha}1-Antitrypsin Inhibits the Activity of the Matriptase Catalytic Domain In Vitro
Am. J. Respir. Cell Mol. Biol., December 1, 2008; 39(6): 631 - 637.
[Abstract] [Full Text] [PDF]

Home page
 Eur Respir JHome page
M. Griese, M. Kappler, A. Gaggar, and D. Hartl
Inhibition of airway proteases in cystic fibrosis lung disease
Eur. Respir. J., September 1, 2008; 32(3): 783 - 795.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Koller, M. Kappler, P. Latzin, A. Gaggar, M. Schreiner, S. Takyar, M. Kormann, M. Kabesch, D. Roos, M. Griese, et al.
TLR Expression on Neutrophils at the Pulmonary Site of Infection: TLR1/TLR2-Mediated Up-Regulation of TLR5 Expression in Cystic Fibrosis Lung Disease
J. Immunol., August 15, 2008; 181(4): 2753 - 2763.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Crit. Care Med.Home page
F. J. Accurso
Update in Cystic Fibrosis 2007
Am. J. Respir. Crit. Care Med., May 15, 2008; 177(10): 1058 - 1061.
[Full Text] [PDF]

Home page
 Eur Respir JHome page
S. Brennan
Revisiting {alpha}1-antitrypsin therapy in cystic fibrosis: can it still offer promise?
Eur. Respir. J., February 1, 2007; 29(2): 229 - 230.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Permissions
Right arrowRequest Permissions
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (14)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Griese, M.
Right arrow Articles by Hartl, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Griese, M.
Right arrow Articles by Hartl, D.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS